A matematika szinte kezdettől a neo-darwinizmus egyik legfőbb mumusa. (A paleontológia a másik.) Neumann János, Kurt Gödel, Fred Hoyle, Marcel-Paul Schützenberger, Gian-Carlo Rota, William Dembski, John Lennox, David Berlinski: csak néhány név azok közül az ismert matematikusok közül, akik erős kételyeiknek adtak hangot. A neo-darwinista evolúcióelmélet matematikai valószínűségével foglalkozó 1966-os Wistar konferencia szintén óriási kérdőjelet tett a hipotézis plauzibilitása mellé. Ez valamelyest magyarázza, miért húzódoznak neo-darwinista biológusok attól, hogy elvégezzék az elméletnek azt a fajta matematikai ellenőrzését, amely a fizikában például, amely eszközként használja a matematikát, magától értetődő. (Az ismert darwinista E. O. Wilson a biológia esetében egyenesen szükségtelennek nevezte a matematikai ellenőrzést, ami szerintem elképesztő.) Egy emberi evolúcióval foglalkozó friss tanulmány azonban ismét demonstrálja, hogy a tagadás ellenére milyen komoly problémáról van szó.

John Sanford a Theoretical Biology and Medical Modelling szaklapban jelentette meg “The waiting time problem in a model hominin population” c. tanulmányát, amely az emberi evolúció neo-darwinista magyarázatának matematikai képtelenségeire hívja fel a figyelmet. A cikk azt modellezi matematikai számításokkal, hogy a becsült hominida populációval a rendelkezésre álló idő alatt valóban lehetséges volt-e az a változás, amelyre a neo-darwinista elmélet szerint a random mutáció, a természetes szelekció és a genetikai sodródás elvileg képessé tette ezt a populációt. Magyarul: igazolható-e matematikai modellezéssel az emberi evolúció. Az elméletnek a matematikával mindenképpen összhangban kell lennie, hiszen ha a számítások szerint lehetetlen ilyen mértékű változás, akkor nincs okunk feltételezni, hogy az úgy történt, ahogy az elmélet mondja. A matematikai számításoknak ugyanúgy ellenőrizniük kell a neo-darwinista evolúcióelméletet, mint egy épület statikai terhelhetőségét, vagy azt a tézist, hogy egy perben a gyanúsítottnak volt ideje elkövetni a gyilkosságot. Vajon elbírják-e a számok a terhelést, amit Darwin elmélete helyez a paleontológiai evidenciákra?

A Mendel’s Accountant program a fehérjekódoló nukleotid láncokat funkcionális jelsorokként értelmezte, ennek megfelelően készített reális szimulációt a lehetséges változásokról. A nemzőképes hominin populációt standard paleodemográfiai becsléseknek megfelelően 10 000 főben határozta meg, a populáció nemzedékváltását pedig 20 évben. A szelekciós erőt nagyon magasra, 50%-os kiszórásra állították. A cél jelsorok véletlenszerű elérésekor (ez felel meg a szelekciós előnyt jelentő mutációnak) és az előnyös változás populációban való fixálódásakor feljegyezték az eredményt. A szimuláció azt mutatta, hogy már egy két nukleotidból álló lánc kialakulásához és fixálódásához is 84 millió évre volt szükség. (Összehasonlításként: az emberré válás teljes folyamatának mindössze 6 millió évbe kellene beleférnie!) Öt nukleotidból álló lánc kialakulásához a szimulációban 2 milliárd (!) év kellett, egy hatos lánchoz 4 milliárd év (ami több, mint amióta élet van a Földön). És ez még mindig csak egyetlen hat nukleotidból álló lánc lenne. A mutációs ráta növelésével, nagyobb szelekciós előnnyel és bővebb populációval a várakozási idő csökkent, de az adatok úgy is kizárták annak a lehetőségét, hogy random mutáció és természetes szelekció a rendelkezésre álló idő alatt előidézhette a szükséges változások akár töredékét is.

A „várakozási idő” közismert problémája négy részből áll. Először is egy kis populációban hosszú időre van szükség ahhoz, hogy egy specifikus nukleotid (genetikai „betű”) helyére véletlen mutáció révén egy másik nukleotid kerüljön. Másodszor, nagyságrendekkel több időre van szükség ahhoz, hogy egy specifikus nukleotid láncból véletlen mutáció révén egy másik specifikus nukleotid lánc alakuljon ki. (Egy új, értelmes szó véletlen kialakulása összehasonlíthatatlanul nehezebb, mint egy új betűé.) Harmadszor, az új nukleotid láncot (új értelmes „szót”) a genetikai sodródás nagy valószínűséggel kiszórja, ezért több alkalommal kell létrejönnie ahhoz, hogy megkapaszkodhasson a populációban. És végül, a megkapaszkodott „szó” esetében további hosszú időre van szükség ahhoz, hogy az előnyös mutációt a természetes szelekció fixálja a populáción belül. A matematikai számítások szerint ezek a nehézségek a rendelkezésre álló idő alatt áthidalhatatlanok, és ez olyan probléma, amely lényegében kizárja az ember eredetének neo-darwinista magyarázatát. (Nem kisebb tekintély, mint az oxfordi biológus Denis Noble beszél ma már a neo-darwinista szintézis bukásáról.)

Darwin annak idején azt mondta, minden azon múlik, hogy van-e elég idő a változásokhoz. Ez a hosszú földtörténeti korok miatt akkor úgy tűnt, nem lehet gond, különösen mivel Mendel genetikája a változás mechanizmusát is prezentálta. A neo-darwinista hatásmechanizmussal kapcsolatos matematikai számítások azonban rendre azt mutatják, hogy a rendelkezésre álló idő nagyon (prohibitíven) kevés. A matematikai modellezés eredményeit alátámasztani látszanak a valós idejű kísérletek, mint Lenski E-coli kísérlete, valamint a maláriát okozó parazita és a HIV-vírus változásaival kapcsolatban szerzett ismereteink is. (Ezek a nagy populációjú, gyorsan reprodukálódó organizmusok hosszú evolúciós folyamatokat tudnak leképezni, ezért a megfigyelések nagyon fontosak.) Mind a matematikai számításokból, mind a valós idejű kutatásokból az derül ki, hogy ahhoz, hogy egy olyan kicsi populációban, mint a hominidáké, végbemenjen egy ilyen nagy változás, mint az emberré válás, nem hogy a rendelkezésre álló néhány millió év nem elég, de maga a Föld és az univerzum kora sem tudná azt megvalósítani. A híd egész egyszerűen túl messze van.

***

(Az 1966-os Wistar konferencia 50. évfordulójára a londoni Royal Society a Brit Tudományos Akadémiával karöltve újabb találkozót rendez. A találkozón ismét komoly viták várhatók, tekintve hogy a konferencia kimondott célja új szintézis keresése, és egyaránt jelen lesznek az össztűz alatt lévő neo-darwinista szintézis hívei, mint Douglass Futuyma, és a szintézis néhány ismert kritikusa, mint az oxfordi Denis Noble és a chicagói James Shapiro professzorok. Az újabb konferencia azt mutatja, hogy a darwini evolúcióelmélet körüli viták nem hogy nincsenek lezárva, de talán soha nem voltak annyira nyitottak, mint most.)

353 hozzászólás a “Lucytől Ádámig: a híd túl messze van?” bejegyzéshez

  • tothaa says:

    Tehát, most újra megerősítették, hogy annak a valószínűsége, hogy az őslevesből ember legyen elégé nagyon közelít a nullához. (ezt már tudtuk, de ezt most egy szakszerű és friss tanulmány hozta ki)
    Azonban ez még mindig nem jelenti azt, hogy nem történhetett meg ez az evolúció.

    Szóval így a természettudósaink még mindig nem tudnak eleget a pontos igazságból és nem mondhatjuk, amit Sherlock Holmes mondana: “When you have eliminated the impossible, whatever remains, however improbable, must be the truth.”

  • dzsaszper says:

    Kicsit a linkek mögé olvasva, angolul tudóknak különösen is ajánlom Denis Noble válaszát a neo-darwinista kritikákra.

  • A poszt gondolatmenetében mintha összemosódna az evolúciós modell mint olyan és a randomitás mint attól különálló hittétel. Ami lehetővé teszi, hogy újra hangsúlyozzuk: az evolúció NEM szól az Élet kezdetéről és/vagy randomitásáról. A véletlenszerűségben spekulatív alapon hívők tényleg nagy matematikai gondban vannak, de ez a gond nem terjed ki az evolúciós modellre. Logikátlan dolog randomitást feltételezni a világban, minden komoly filozófus az ellenkezőjére jutott.

    Az evolúció racionális kritikája nagyon helyes és üdvözlendő, ám érdemes felfigyelni arra, hogy az evolúció egyelőre csak intuitív részletességű modell, mindössze annyit állít biztosan, hogy Isten nem a mai formájukban teremtette a ma látható élőlényeket, hanem azoknak voltak előző formáik. Elképzelhető, hogy minden mai élőlény néhány különböző, vagy akár egyetlen őskori sejtből fejlődött ki. (Amelyről sem megerősíteni, sem megcáfolni nem tudjuk, hogy Isten teremtette, ám épp a randomitás matematikai problémái hívják fel arra a figyelmet, hogy az Isten általi teremtés plauzibilisebb lehet, mint az ellenkezője.)

    A Lucie-matematika egyébként nem erre vonatkozik, hanem az evolúció ma feltételezett mechanikájára, és azt kritizálja. Valószínűleg nem értjük ma még a DNS gyors változása mögötti mechanizmusokat, de ezek feltehetően léteznek, és születés után is működnek. Ha ugyanis nem lennének, akkor hiába érné túlélési stressz az élőlényt, már késő lenne, nem tudna változtatni menet közben a DNS-én. És így aztán tényleg nagyon lassú és random elhullásra/túlélésre alapozódó lenne az evolúció. Miközben a valóságban azt tapasztaljuk, hogy a szelekciós nyomás születés után is alakítja a DNS-t, és a tanulságot a szervezet képes gyorsan – és nem random módon – továbbörökíteni. A DNS-be a tökéletesedésre törekvés is be van kódolva, ez pedig nem lehet random algoritmus. Ellenkező esetben nem csak azt kellene elhinnünk, hogy a Hamlet magától létrejön a földre szórt betűkből, hanem azt is, hogy a Hamlet tudatos továbbfejlesztése mögött sincs szándék. A kérdés egyelőre nincs részletesen leírva, de a szemünknek azért hihetünk, nem?

    Ádám, az utóbbi időben a te álláspontod is mintha közeledne az evolúcióshoz, hiszen úgy véled, hogy a teremtés nem mai, hanem korábbi formákat hozott létre. Én ezt tartom az evolúció és annak elutasítása közötti vízválasztónak, a részleteket pedig fokozatosan finomítja a hívők által is helyeselt és gyakorolt természettudomány. A természettudomány azonban SOHA nem tud érvényesen állást foglalni az Isten általi teremtés vs. random keletkezés témában, legfeljebb demonstrálhatja az utóbbi feltevés matematikai/logikai abszurditását.

  • csmatyi says:

    tothaa hozzaszolasahoz megjegyeznem hogy csak azert mert valaminek van eselye nem biztos hogy be is kovetkezik. Vannak olyan esemenyek, amelyek gyakorlati kis valoszinuseguk miatt nem kovetkeznek be.

  • dzsaszper says:

    Kedves László,

    egész jól megfogalmaztad: leginkább az abiogenezis és a kezdeti filogenezis — az élet kezdetével kapcsolatos dolgok — ami a legnagyobb indulatokat szítják és ami körül a legtöbb a probléma. (Talán még egy olyan aprócska kérdés a problémás mint a homo sapiens létrejötte)

  • tothaa says:

    @csmatyi
    Én nem azt mondtam, hogy ha valaminek van esélye akkor az biztos be is következik; ezt nem állítom. Viszont az mondom most, ha valami nem következik be az nem azért nem következett be, mert kicsi volt a valószínűsége, hanem azért mert a sok lehetőség közül egy másik valósult meg, de ennek semmi köze a valószínűségéhez.
    Azt próbálom mondani, hogy van különbség aközött, hogy valami lehetetlen és valaminek 0 a valószínűsége. Annak a valószínűsége, hogy február negyedikén az autódra hulljon egy repülőgép, az pontosan 0, ez minden egyes emberre nézve igaz. De ez mégsem lehetetlen, például egy tájváni taxissal megtörtént: https://www.youtube.com/watch?v=RSoZOsIC25M
    Ellenben a bilokáció egy lehetetlen esemény; jelenlegi ismereteink szerint hogy ugyan az az asztal az emeleti konyhában és a pincében is ott legyen egy időben, nem csak, hogy 0 a valószínűsége, de lehetetlen is. (ha mégis van ilyen akkor az a természetfeletti csoda)
    Az a kérdés, hogy az ember létrejötte az evolúciók sorozatán keresztül a Föld keletkezése óta lehetetlen esemény-e, vagy csak nagyon kicsi a valószínűsége…
    Mert ha lehetetlen, akkor bizonyára rossz volt az elmélet és el kell vetni.
    De ha csak nagyon kicsi a valószínűsége, vagy ha egyenesen 0 a valószínűsége, akkor abból még nem bizonyítható, hogy nem igaz az elmélet, persze pláne az sem, hogy igaz lenne. Hiszen 0 a valószínűsége annak is, hogy a repülő éppen akkor arra a taxisra essen, de hát mégis megtörtént….

  • Szabados Ádám says:

    tothaa,

    abban természetesen igazad van, hogy valószínűtlen események bekövetkezhetnek. Viszont az, hogy egy repülő éppen az én autómra esik, azért mégis hihetőbb, mint az, hogy minden nap ráesik egy repülő az autómra, én mégis minden nap túlélem, vagy az, hogy minden nap éppen három Airbus 380-as esik rá az autómra, és mindig éppen három, hetven éven át, én pedig minden nap túlélem. Az a szerencsesorozat, amit a neo-darwinizmus feltételez, inkább az utóbbival analóg.

    De a lényeg nem ez, hanem az, hogy a neo-darwinizmus tudományos elméletként magyarázattal próbált szolgálni az élet és a biokomplexitás kialakulására. Felkínált egy mechanizmust, ami az elmélet szerint megmagyarázza a feltételezett átalakulást az egyszerű életformáktól a mostani változatosságig. Ez a mechanizmus a véletlen mutáció és a természetes szelekció, valamint a genetikai sodródás. Csakhogy ez a mechanizmus nem magyarázza meg a változást, mert matematikailag az esélye gyakorlatilag nulla. Nem nehéz belátni, hogy ezen a ponton nem sokat segít, ha azt mondjuk: azért a lehetetlen és a valószínűtlen között van különbség. A bizonyítás terhe az elméleten van, és jelenleg nagyon rosszul áll a szénája.

    Amikor azt látom, hogy egy magyarázat nem működik, másik után nézek. Ez történik most a tudomány világában is, függetlenül attól, hogy hithű dogmatisták még mindig azt gondolják, hogy a neo-darwinista evolúcióelmélet bizonyított tény. Ami szerintem az egész terület válságát okozza, az a teleológia elvi alapú elvetése. A napnál is világosabb, hogy a biológiában teleológiai elvek érvényesülnek, rendszerszinten működnek a dolgok, a magyarázatok között mégis a perifériára szorultak a teleológiai alapú magyarázatok (l. ID). Sokan inkább elhiszik, hogy bár a valószínűsége a nullához konvergál, az erózió, a szél és a napenergia építette meg a felhőkarcolót (vagy ha nem ezek, akkor valami más irányítatlan anyagi folyamat), minthogy megnyissák az utat az ésszerű magyarázat előtt, hogy a jelenség magyarázatához feltételezni kell az intelligens okot és a teleológiai szempontokat. Ez viszont már nem tudományos nyitottság, hanem metafizikai előítélet, amit naturalizmusnak neveznek.

  • Szabados Ádám says:

    Ezt még ide belinkelem

  • Szabados Ádám says:

    László,

    továbbra is azt gondolom a témáról, amit ebben a sorozatban megírtam, nem változott a véleményem.

  • Ádám, aki intelligens tervezést vall, az a saját keretén belül nem mondhatja érvényesen, hogy Isten egy korábbi állapotú embert teremtett, aki azután valahogy magától továbbfejlődött, mert ez már evolúció. Azt mondhatja érvényesen, hogy Isten akárhány ponton beavatkozva megteremtett akárhány életformát a történelem során. Oké, ez tényleg ID, csak olyan logikát követ, mint hogy Newton almáit mindig Isten húzza le a földre, egyenként. Tehát az almák leesésének oka nem holmi általános (előre megalkotott) gravitáció, hanem minden esetben közvetlenül maga Isten. Utóbbi nem egy respektált tudományos elmélet. Ez magyarázza, hogy a hasonló logikára épülő ID miért nem lett, és soha nem is lesz, respektált tudományos elmélet, amíg racionális ember él a földön. (Ha már nem él ilyen, akkor meg nem lesz semmilyen elmélet.)

    Próbáljuk megérteni az „ateisták” logikáját: 1. tapasztaljuk, hogy vagyunk, tehát nem igaz, hogy nem lehetünk; 2. a létünk oka tetszőleges, kivéve Istent; 3. minden állítás jó, amivel látszólag át tudjuk hidalni a nemlét és a lét közötti szakadákot.

    Persze ez a narancs kicsit savanyú, kicsit sárga, de akkor is az ateisták narancsa.

    Próbáljuk megérteni a teisták logikáját is: 1. tapasztaljuk, hogy vagyunk, tehát a létünknek kell legyen oka; 2. a létünk oka tetszőleges, kivéve hogy esetleg nincs oka; 3. minden állítás jó, amivel látszólag át tudjuk hidalni az ok nélküliség és az okkal levés közötti szakadékot.

    Ez a narancs is kicsit savanyú, kicsit sárga, de akkor is a teisták narancsa.

    Mindkét logika teljesen neccess. A korrekt logika így néz ki: 1. tapasztaljuk, hogy vagyunk, de a létünknek nem tudjuk sem az okát, sem a forrását; 2. igyekszünk minél többet megtudni erről a kérdésről, de belátjuk, hogy kizárólag intuitív munkafeltevéseink lehetnek; 3. az ügy eldöntése helyett a gyakorlati vonzataival foglalkozunk (lásd: Pascal fogadása, Kant erkölcsi istenérve). Elég megnézni az utóbbi kettőt ahhoz, hogy belássuk Isten gyakorlati szükségességét. Elvben nem tudjuk eldönteni az Isten-kérdést, a gyakorlatban azonban kezdettől el van döntve. Isten nélkül egyetlen embercsoport sem tud sikeresen létezni.

    Ezt az emberek is érzik belül, így ha Isten-megvonással bünteti őket az értelmiség vagy a karhatalom, akkor ösztönösen Isten-pótlékhoz folyamodnak, legyen az babona, ezotéria, kritikátlan liberalizmus vagy fanatikus szekularizmus. Ahogy ennünk kell, úgy Istenre vagy Isten-pótlékra is szükségünk van az életben maradáshoz. Hazudhatjuk kolbászmajszolás közben, hogy fénnyel táplálkozunk, de ez nem látványosan nem lesz igaz. Hazudhatjuk abszolút tekintélyekre hivatkozás közben, hogy nincs Isten, de a tetteinkkel bizonyítjuk, hogy belül mást hiszünk.

  • Szabados Ádám says:

    László,

    a cikk arról szól, hogy matematikai számítások szerint a neo-darwinista mechanizmus nem hozhatta létre az embert a hominidák nagyjából tízezer nemzőképes egyedre becsült populációjából. Az én véleményem az, hogy teleológiai szempontok és intelligens ok figyelembe vétele nélkül semmilyen irányítatlan anyagi folyamat nem fogja tudni megmagyarázni a biokomplexitás létrejöttét, mert minden tapasztalatunk azt mutatja, hogy nagy mennyiségű CSI-nak és funkcionális, teleológiai rendszereknek intelligens okai vannak, a működés és a jelentés szintjei pedig nem azonosak egymással.

  • Szabados Ádám says:

    Ez magyarázza, hogy a hasonló logikára épülő ID miért nem lett, és soha nem is lesz, respektált tudományos elmélet, amíg racionális ember él a földön.

    Ez azért így nem egészen igaz.

  • Helyesen: „Hazudhatjuk kolbászmajszolás közben, hogy fénnyel táplálkozunk, de ez látványosan nem lesz igaz.”

    Röviden: mivel nincs ember a világon, aki ne hivatkozna napi szinten abszolútként kezelt tekintély(ek)re, ne tekintene szentnek és sérthetetlennek bizonyos dolgokat, továbbá ne akarna szent küldetésként elérni valamit embertársai körében, a gyakorlatban legalábbis tudat alatt minden ember hívőként viselkedik. A többség belátja ezt, és istenhívő, egy szűk kisebbség pedig istenmentes fanatizmushívő, és közben tudománytalanul emlegeti az evolúciót. Úgy tesz, mint ha az evolúció bármit állítana Istenről, a hívők meg úgy tesznek, mint ha ezt elhinnék.

    Ha hívőként jelezzük, hogy az evolúció semmit sem mond Istenről, akkor az átverés sikertelen lesz, és megszabadulunk egy gumicsonttól. Az, hogy Lucy-ból matematikailag létrejöhetett-e a mai ember, semmit sem mond arról, hogy Lucy, vagy a Lucy-t megelőző hominida, vagy Lucy egyetlen őssejtje hogyan jött létre, ez intuitív metafizikai találgatás tárgya, és kívül esik a tudománnyal kezelhető körön.

  • csmatyi says:

    Vertes ur,

    Remelem hallott a SETI nevezetu szervezetrol. Ez a Search for ExtraTerrestrial Intelligence. Az volt a celjuk, hogy olyan jeleket fedezzenek fel a vilagegyetemben amelyek esetleg foldonkivuli intelligenciara utal. Emlekezzunk, adofizetok tobb tiz millio dollarokat fizettek ezert a programert, tehat ahol a szad, legyen ott a penzed is. Mindenesetre azt talaltak ki, hogy ha olyan jelet kapnak, amelyek a primszamok sorozataval azonos, az jel intelligens leny jelenletere. Ez olyan jel, ahol egy alapzaj felett magas amplitudo sorozatok vannak, ahol 2, 3, 5, 11, stb. amplitudok surun vannak egymas utan. Es ezek mind vilagi tudosok voltak, mondhatni ok is az Intelligens Tervezes kutatoinak az elkepzeleseit igazoltak is. Tehat ha felfedezunk mas jeleket a termeszetben amelyek termeszetfolotti intelligenciara utalnak, nem ertem, miert van barkinek ezzel baja?

  • csmatyi says:

    Vertes ur,
    “A többség belátja ezt, és istenhívő, egy szűk kisebbség pedig istenmentes fanatizmushívő, és közben tudománytalanul emlegeti az evolúciót.”
    Azert nem mas, mint Ernst Mayr nagy nevu evolucionista mondja azt hogy az evolucio az tortenelmi tudomany, nem egzakt tudomany. Hat, az evolucio olyan dolgokrol beszel amelyek a regmulatban zajlottak le egyszer. Magyarul megfigeylhetosegnek vagy az ismetelhetosegnek halvany remenye sincsen, pedig ez a tudomanyossag legfobb kriteriuma. Mondta is nekem a volt temavezetom az ELTE TTK tudomanyfilozofia tanszeken is.

  • dzsaszper says:

    Kedves László,

    “aki intelligens tervezést vall, az a saját keretén belül nem mondhatja érvényesen, hogy Isten egy korábbi állapotú embert teremtett, aki azután valahogy magától továbbfejlődött, mert ez már evolúció.”

    De igen, ettól még mondhatja érvényesen. És igaz, ez megenged egyfajta evolúciót is. 🙂 Csupán az evolúció önmagában, úgymond vak órásmester módjára elégtelen magyarázat a számára.

  • dzsaszper says:

    Amúgy a savanyú narancsaid nagyon jól illusztrálják azt az áltudományos műbalhét, amibe könnyen belefut manapság az ember, akkor is, ha nem akar.

  • dzsaszper says:

    Matyi,

    szerintem kicsit kevered a tudomány (avagy science) több jelentését. Azért nem írok természettudomámyt, mert a természettudományok és a történettudományok között van átfedés, a geológia és a csillagászat jó része is ebbe az átfedésbe tartozik.

  • csmatyi says:

    @dzsaszper
    En kulonbseget tettem a ket tudomanyfogalom kozott. Az evolucio nem egzakttudomany, hanem torteneti tudomany. Axiomaja az, hogy minden ma zajlo folyamat, pl. geologiai leretegzodes a multban is mindig ugy folyt, pedig senki soha nem figyelte meg. Azzal operal, hogy kizarolag csak termeszeti folyamatok jatszodhatnak le. Ebbol adodik az evolucio ateista jellege, es ezert is utkozik a bibliai teremtessel. Sok ateista tudos abba a falba utkozik, hogy “mivel en a tudomanyos vizsgalodasiam folyaman csak a termeszetet figyelem, csakis az letezik”. Ez alaptalan.

    Ezzel szemben, ha feltetelezzuk, hogy a Biblia igaz, ez ugyan meghatarozza a kutatasi semaunkat, de ettol fuggetlenul vegezhetunk kutatasokat. Pl. a Biblia szerint Isten az allatokat es a novenyeket ugy teremtette, hogy azok bizonyos nemekbe, tipusokba rendezodnek. Es nicsak lass csodat, lehet ezalapjan teremtes taxonomiat vegezni: http://www.coresci.org/bdist.html

  • csmatyi says:

    @Vertes Laszlo
    “Röviden: mivel nincs ember a világon, aki ne hivatkozna napi szinten abszolútként kezelt tekintély(ek)re, ne tekintene szentnek és sérthetetlennek bizonyos dolgokat, továbbá ne akarna szent küldetésként elérni valamit embertársai körében, a gyakorlatban legalábbis tudat alatt minden ember hívőként viselkedik. A többség belátja ezt, és istenhívő, egy szűk kisebbség pedig istenmentes fanatizmushívő, és közben tudománytalanul emlegeti az evolúciót. Úgy tesz, mint ha az evolúció bármit állítana Istenről, a hívők meg úgy tesznek, mint ha ezt elhinnék.”

    Roviden: mi a Biblia altal felvazolt vilagkepet es eszerint vegezzuk kutatasainkat. Az evolucionistaknak nyilvanvaloan mas axiomarendszere van:
    -hosszu korszakok
    -uniformitarianizmus
    -az anyag minden, ami valaha volt, van es lesz (Rousseau)

    Az evoluciot mindenkibe beveretek az iskolaban, es semmi nem tudja az evolucionista embert masrol meggyozni. Azt hiszi, nyitott gondolkodasu ember, de kozben rendkivul elfogult a sajat elmeletevel kapcsolatban. A kommunizmus tanulsaga az, hogy ha egy eszmet nagyon nyomjak, pl. az iskolakban, akkor azt igenis meg kell kerdojelezni, meg kell vizsgalni.

    Javaslom neked, olvasd el: Jerry Bergmantol: Slaughter of the Dissidents, es a Silencing the Darwin Skeptics. Lesz meg harmadik kotet ebben a sorozatban, amelyhez en is hozzairtam a sajat tortenetemet. Igazan meg fogsz lepodni azon, mik mennek az amerikai akademiakon.

  • endi says:

    csmatyi, erre szokták előhúzni az aduászt: occam borotvája. ami hát ügye egy jól használható elv, csak éppen nem mindig igaz… csak hát ügye a mai kornak nem az számít, hogy nem mindig igaz, hanem csak az, hogy jól használható általában 😀

  • Lima Rui says:

    Melyik paleontológiai lelet mond ellent az evolúciónak? A lovak evolúciója szépen fel van térképezve: https://hu.wikipedia.org/wiki/A_lovak_evol%C3%BAci%C3%B3ja
    Az általad hivatkozott tanulmány már alapfeltevésében is hibás. (Bár bevallom, csak a fontosabb részeket olvastam el, így ha valamire ad magyarázatot, amit felvetek, azt nyugodtan idézzétek.)
    „The human mutation rate is approximately 10 to -8 per nucleotide per generation”Ez eddig oké. És utána a logika megfárad. Ahogy írja 3 milliárd bázispárból áll az emberi genom, így minden utódban van 30 új PONTmutáció. Ez valójában több lesz, hisz ez minden sejtosztódásnál megtörténik és a legtöbb sejtben, így a csíravonalban is már 40-50 lesz. Az unoka már 100 olyan mutációt hordozhat, amit a szülő nem és így tovább. 150 ezer generáció, azaz 3 millió év múlva ez 7,5 millió lenne, de közben a leszármazási vonalba más családfák leszármazottai is bekerülnek a maguk mutációival. A cikk szerint 150 millió nukleotid eltérés van köztünk és a csimpánzok közt. Ha egy hipotetikus belterjes család 7,5 millió pontmutációt halmozhatna fel 3 millió év alatt, akkor a 10 ezer fős kezdőpopulációból bőven összejön a 150 millió (20 x 7,5 millió) mutáció. Pár apróság, amit a cikk szerzői nem tudtak: nem csak pontmutációk, hanem inszerciók, deléciók, kromoszóma átrendeződések: szétválások és összeolvadások is léteznek. Konkrétan az ember evolúciója során összeolvadt 2 ősi kromoszóma, így nekünk 46 van, a csimpiknek meg 48. Erről valahogy elfeledkeztek a szerzők. De még árnyaltabb a kép: Az említett 150 millió nukleotidnyi eltérés jelentős része valószínűleg neutrális mutáció: nem kódoló régiókban, samsense mutáció vagy ha változik is az aminosav annak a karaktere hasonló vagy a fehérjének egy jelentéktelen része változik meg, ami eukariótáknál viszonylag nagy arányú. Így mindjárt maga az emberré válás kevesebb mutációból is megvalósulhatott volna, a többi csak génsodródás. Mellesleg a gének, így a pontmutációk nem önmagukban öröklődnek, hanem kromoszómákba rendeződve, azaz kapcsoltan, melynek mértéke sokféle lehet, függ a kromoszóma méretétől, gének egymástól való távolságával, kromoszómán elfoglalt helyüktől. Igen, eljutottunk a rekombinációhoz (tudom, a cikk eléggé lebecsüli a jelentőségét). És ne felejtsük a transzkripciós faktorokat: azok expressziójának változása gének tucatjainak működésére lehet hatással, így akár 1 nukleotid változás is hatalmas fenotipikus változást, és így szelektív előnyt okozhat. Pl. a híres Hox géneket érdemes tanulmányozni meg a többi mester regulátort, kis RNS-ek.
    Javaslom ennek a cikknek is az elolvasását. Én ugyan csak átfutottam ezt is, de mivel a blog írója és legtöbb olvasója kételkedik az evolúcióban, így nekik érdemes alaposan áttanulmányozni és hibát keresni ebben a hatalmas munkában, amit a szerintük félrevezetett alkotók elkövettek.
    http://www.nature.com/nature/journal/v437/n7055/full/nature04072.html

    Másik témában a blogon volt szó a pszeudogénekről. Rákeresve az „apoptosis” kifejezésre található is 1 emberre specifikus pszeudogén, mely csimpánzban és egérben is működik, caspase-12-ként. A blog írója feltételezte, hogy ezeknek a pszeudogéneknek lehet funkciója, csak mi nem tudjuk. 1) Ilyen erővel bármiről feltételezhetünk bármit és a szomszéd kavics tanulmányozásával is eltölthetünk millió éveket. 2) Ez a szekvencia csak pár pontmutációval tér el a csimpánz szekitől. Pl 1 korai stoppal. De a blog szerzője ezeknek a szekvenciáknak egy eddig nem ismert funkciót tulajdonít (van talán erre utaló jel?), nem pedig azt, hogy az évmilliók során kialakult egy stop jel, de mivel csak egy enyhe negatív hatásról van szó, így rögzülhetett (Ezt nem tudom, de lehet, hogy kapcsolt egy erős fitneszt okozó mutációval. Vagy tényleg csak simán belefér ezen funkció elvesztése.) A többi fajban van ismert (fehérjekódoló) szerepe ennek a szekvenciának, ami ráadásul azonos, csak pont bennünk rendelkezik egy teljesen új, eddig nem ismert feladattal, melyre semmi sem utal, de melyhez szükség volt pár pontmutációra, pl egy korai stop-ra??? Hmm.

  • Szabados Ádám says:

    Kedves Lima Rui,

    1) Ami a paleontológiát illeti: Darwin elméletének kezdettől paleontológusok voltak a legnagyobb kritikusai. Louis Agassiz a kor legjelentősebb paleontológusaként rendre emlékeztette Darwin követőit arra, hogy a leletek nem támasztják alá az elmélet gradualizmusát. Erre jutott Stephen Jay Gould és Nile Eldredge is, akik a 80-as években publikált írásaikban kijelentették: „a neo-darwinizmus halott”. (Gould persze evolucionista volt, de a neo-darwinizmus gradualizmusát összeegyeztethetetlennek látta a leletekkel.) Mark McMenamin, a kambriumi időszak egyik legelismertebb kortárs kutatója szerint a neo-darwinista magyarázatok nyomorúságos kudarcot vallottak az ő szakterületén. Géczy Barnabás szintén arról írt, hogy a paleontológia ismeretei összeegyeztethetetlenek a neo-darwinizmus gradualizmusával. Nem véletlen, hogy olyan új elméletek születnek, mint a “punctuated equilibrium”, a “homeosztázis” vagy az “evo-devo”.

    2) Ami a mutációkat illeti: a cikk nem feledkezett meg az inszerciókról és deléciókról. Belinkeli például Elena SF, Ekunwe L, Hajela N, Oden SA és Lenski RE tanulmányát (Distribution of fitness effects caused by random insertion mutations in Escherichia coli. Genetica. 1998;102/103:349–58.), amely éppen azt mutatja ki, hogy a hasznos mutáció elképesztően ritka. A cikk számos más tanulmányt is belinkel, mely hasonló következtetésekre jutott. Nem erősíti az érvelésedet, ha kiválóan képzett tudósokról alapvető tudás hiányát feltételezed, az ilyen inkább arrogánsnak hat.

    3) Ami a számításokat illeti: a tanulmány tendenciózusan nagylelkű a lehetőségekkel kapcsolatban, már maga az 50%-os szelekciós ráta is rendkívül nagyvonalú, a mutációkat is stabilnak kezeli, kizárja a visszamutálódás lehetőségét, stb. Tehát nem szűkre, hanem inkább irreálisan tágra veszi a neo-darwinista mechanizmus lehetőségeit, és így jut mégis arra a következtetésre, hogy matematikailag lehetetlen a megvalósulás.

    4) Ami a Hox géneket illeti: azok valóban radikális változásokat képesek előidézni a dGRNs-ben, és látványosan más mutáns fenotípust tudnak előállítani. Ez köztudott. Csak van velük egy kis probléma. Ezek a mutációk rendre nem előnyös, hanem hátrányos változások. A gyümölcslegyek esetében a dGRNs-ekbe való beavatkozás súlyos károsodással, sokszor halállal végződött (pl. rövid vagy göndör szárnyú, szem nélküli, fején lábakat növesztő torz egyedek jöttek létre). A kísérletek nem azt igazolják, hogy a Hox géneknek evolúciós potenciáljuk lenne. Szathmáry Eörs és mások éppen ezért tagadják, hogy a Hox géneknek lenne bármiféle kreatív jelentőségük az evolúciós folyamatban. Az pedig, hogy a sejt nem csak a DNS-ben hordoz információt, hanem epigenetikai szinteken is, nem egyszerűsíti, hanem tovább súlyosbítja a matematikai problémát.

    5) Éppen most jelent meg egyébként egy tanulmány, amely több mint 60000 ember genetikai változásait vizsgálja. Az Exome Aggregation Consortium (ExAC) nagyjából 1.2 milliárd mutációt vizsgált meg, melyek közül egyetlen egy előnyös változásról sem tudott beszámolni. A nagy mintavétel alapján elvégzett vizsgálat azt igazolja, hogy az előnyös mutáció – ha van egyáltalán – iszonyatosan ritka. A neo-darwinista evolúciós mechanizmus tehát már a várakozási idő első problémájánál látványosan elakad.

    6) Ami a csimpánzok és az ember közötti genetikai hasonlóságot illeti: a Nature-ben megjelent általad belinkelt cikk rengeteg kérdést vet fel, amelyre sokféle választ adtak már, többek között ezt, ezt, ezt és ezt a cikket ajánlom.

    7) Ami a pszeudogéneket illeti: a bizonyítás terhe mindig annak a vállán van, aki állít valamit. A pszeudogénekről neo-darwinista biológusok és genetikusok állítják, hogy funkciótlanok és evolúciós folyamatok eredményei. Szerintem ezt az állítást kell bizonyítani, különösen annak a fényében, hogy a nemkódoló genomrészek kapcsán nagyon hasonló állítást cáfolt az ENCODE projekt, és azt tapasztaljuk, hogy szinte minden esetben funkcióra bukkanunk, amikor a haszontalan evolúciós szemétnek gondolt szekvenciák funkciói után kutatunk. Nem levegőbe beszélek tehát, amikor azt gyanítom, hogy lesz a „pszeudogéneknek” funkciója (minthogy egyébként találtunk is már egyes esetekben funkciót), és hogy már maga az elnevezés („pszeudogén”) félrevezető, mert megelőlegezi a végeredményt. De a bizonyítás terhe nem az én vállamat nyomja, hanem azokét, akik a nem-tudásból érvelve azt állítják, hogy az adott génszekvenciáknak nincs funkciójuk. Francis Collins önkritikusan az ilyen állítást nevezte hübrisznek.

    8) Végül a bizonyítás terhével kapcsolatban hadd idézzek két tudóst, akiket nehéz volna tudatlansággal vádolni. Ernst Chain Nobel-díjas fiziológus ezt mondta 1971-ben: „Az, amit a 19. század végi pozitivisták és azok követői állítottak, hogy a legalkalmasabb fennmaradása és fejlődése teljes mértékben véletlen mutációk következménye, vagy akár az, hogy a természet mutációk általi próba-szerencse kísérleteket végez, hogy a fennmaradásra alkalmasabb élő szervezeteket alkosson, olyan hipotézisnek tűnik számomra, melyre nincs bizonyíték és összeegyeztethetetlen a tényekkel. Ez a hipotézis szándékosan figyelmen kívül hagyja a teleológiai szándék elvét, mely ott van a biológus szeme előtt, bármerre is néz, akár egy szervezet különböző szerveit kutatja, akár ugyanazon a sejten belül a különböző elemek egymáshoz való viszonyát, vagy akár különböző fajok egymással való kapcsolatát és interakcióját. Ezek a klasszikus evolúcióelméletek nagy mennyiségű összetett és finom tény leegyszerűsítései, megdöbbent, hogy mennyi tudós, milyen hosszú ideje, mennyire kritikátlanul és készségesen nyeli be, bármiféle tiltakozás vagy morgás nélkül.” A kémiai Nobel-díjas Richard Smalley pedig 2005-ben jelentette ki: „Kémikusként és fizikusként… mondhatom: világos, hogy az evolúció nem történhetett meg.” Ezek az idézetek persze nem bizonyítanak semmit, csak azt, hogy a viták nincsenek lezárva. Egy vitában pedig annak kell bizonyítania, aki állít valamit. Az élet és a biokomplexitás véletlen mutáció, természetes szelekció és genetikai sodródás általi létrejötte nem jelentéktelen állítás. Annak kell bizonyítania, aki állítja. Annál is inkább, mert az állítással szembeni kétely tudományos körökben is rendkívül erős.

  • Lima Rui says:

    1) Valakikre való hivatkozásban igen erős vagy, és ez nem csak erre a pontra vonatkozik. Példáknak örülnék, az építő jellegű beszélgetés érdekében, esetleg linkekkel. Jó lenne, ha nem hiányzó láncszemeken menne a rúgózás (persze ilyet is találtak már bőven) és cserébe én se kérek kambriumi nyulat.
    2) Mint írtam, nem olvastam végig a cikket. De az érvelésem akkor is áll, mert a matematikai modelljük csak pontmutációkra vonatkozik, és mint ők és mi is tudjuk, ennél jóval nagyobb horderejű mutációs események is léteznek, amivel számolni kell egy jó modellnél. És mivel ez igen kiszámíthatatlan, hisz max egy gyakoriságot lehetne felállítani, de az semmit se mondana a jelentőségéről, az érintett területek nagyságáról, gének, struktúrák számáról, így nem is lehet belevenni. Így a modelljük se ér sokat. Ez a modell egy valamire jó: azt mondja meg, hogy az általuk vázolt kiindulási pontból és feltételekkel, csupán pontmutációkkal számolva mennyi idő alakulna ki ÚJRA a ma ismert ember, nukleotidról nukleotidra. De az evolúció nem determinikus, csak a jelenből visszanézve tűnik annak. Igaz, hogy egy bizonyos nukleotid mutációjára az esély 1 a 3 milliárdhoz, de ez minden egyes nukleotidra ugyanannyira igaz, mégis mindig megtörténik 30-50 nukleotiddal. Az ember kialakulása nem volt törvényszerű, csak így történt, lehetett volna másképp is, másféle ember, vagy másféle főemlős kifejlődésével. A 150 milliónyi nukleotid eltérés egy igen jelentős része nélkül is ilyen emberiség alakult volna ki valószínűleg. Azért nem lehet az evolúciót modellezni, mert rengeteg a véletlenszerű folyamat is alakítja. Ezeke a modellek statisztikaiak, ahogy egy bizonyos pontmutáció kialakulása 1 a 3 milliárdhoz, úgy az a bizonyos mutáció megjelenhet akár 1, akár 10 ezer generáció múlva is. Előre nézve az esély 1 a 3 milliárdhoz, de ha már lezajlott a generációváltás, akkor az az esemény vagy lezajlott, vagy nem. És ez mind külön utat jelent onnantól fogva, a lezajlott pontmutáció után újabb 3 milliárd lehetőség lép fel, míg ha egy másik változás lépett fel a 3 milliárdból, akkor 3 milliárdszor 3 milliárd. Az is lehet, hogy egy nagy jelentőségű, igen erős szelektív jelentő mutáció az első generációnál lezajlik, az esély ugyanannyi rá, mint bármelyik másik mutációnál. Előre nézve számít, esélyek latolgatásánál, hogy a mutációk 90%-a neutrális, 9,9% meg letális, de az egyes mutációkra az esély ugyanannyi, akár neutrális, vagy benne van abban a 0,1% előnyösben. Remélem világosan fogalmazok. És itt csak pontmutációkról beszélünk.
    3) Rengeteg szelekciós tényező van, állandóak és időszakosak is. A genomnak nem mindegyik része áll ugyanakkora szelekciós nyomás alatt, különböző génekről, géncsoportokról beszélünk, melyek között akár új kapcsolatok is kialakulhatnak szabályozó régiókban történő mutációk hatására. A populációkat váratlan hatások is érhetik, pl viszonylag gyors geológiai változások, hosszú aszályos időszak, természeti csapások, melyek erősen leszűkíthetik a populációt, véletlenszerűen feldúsítva bizonyos alléleket, genotípusokat. Ezzel se tud számolni ez a modell. Más se. Eleve egy 10 ezer fős populációval számol, de ez nyilvánvalóan alpopulációkra tagolódott, 10-50 fős csoportokra kezdetben, de ez a szám változott időben. Ezekben az alpopulációkban, az alacsony egyedszám miatt elég gyorsan el tud terjedni egy előnyös jelleg, feldúsítva bennük az adaptív előnnyel rendelkező egyedeket, és így, amikor egy ilyen alpopuláció összeolvad egy másikkal, akkor robbanásszerűen elterjed az új genotípus.
    4) Sokféle transzkripciós faktor van. MikroRNS-ek. Transzpozonok, retroelemek. Heterokromatin-eukromatin átrendezős strukturális változások, mutációk miatt. Új transzkripciós faktor kötőhelyek megjelenése kulcsfontosságú gének promóterében új expressziós mintát eredményezhetnek, egész szöveteket változtathatnak meg. Igen, az epigenetika valójában az általad felhozott modell valószerűtlenségét növeli. Az epigenetika jelentős része amúgy benne van a DNS-ben, csak nem nukleotidokban kódolva, hanem struktúrálisan: eu/heterokromatin, citozin metiláció, hiszton kötőhelyek, illetve az egész egyedfejlődést beindító anyai faktorok.
    5) Nincs időm elolvasni a cikket, csak átfutottam. Úgy vettem ki, hogy csupán arról van szó, hogy a fehérje szerkezetét megváltoztató mutációk igen ritkák. Arról nem láttam semmit, hogyan tudnák eldönteni, hogy mely mutáció előnyös. Te hogy tudnád eldönteni? El nem végezhető annyi specifikus vizsgálat ezen a 60 ezer emberen, hogy bírnak e valami előnyös jelleggel. Ha minden elképzelhető módon vizsgálnák őket, akkor se lehetne mindent megnézni. Még ha csak azokat néznék, ahol fehérjeszerkezetet érintő változásról van szó, az is lehetetlen, de a többinél is bármi lehet a szabályozó régiókkal (főleg, hogy szerinted minden apró szekvenciának van valami szerepe). Ráadásul az emberi tudomány, technológia és kultúra ott tart, hogy már elég kevés szelekciós tényező hat ránk. Egyre kevesebb hátrányos mutáció szelektálódik ki az orvostudomány miatt, így egyre kisebb az előnyösek aránya, melyek ráadásul nemigen tudnak elterjedni, hisz sokszor az adaptív előny nem jelenik meg, hisz már ritkán kerülünk természetes élethelyzetbe, illetve a technológia, a társadalom kompenzálja az előnyöket és hátrányokat egyrészt, másrészt torzítja. Lehet, hogy néha felbukkan 1-1 Usain Bolt vagy Michael Phelps, de nem fog elterjedni a geno- és fenotípusuk, mert ezek a régen hasznos képességek, ma már nem sokra jók.
    6) Ok. 1 és 5 pont.
    7) Akkor is érdekes, hogy az általam felhozott kaszpáz-12 gén több vizsgált emlősben, így a legközelebbi rokonunkban is FEHÉRJEKÓDOLÓ funkcióval bír, míg ez a funkció bennünk elveszett és ez fenotipikusan is megnyilvánul, bár gyenge a negatív hatás. A gén 99%-a ugyanaz, az emberi verzióban egy korai stop miatt mégsem alakul egy funkcióképes fehérje, bár a szekvencia többi része ugyanaz. Több, mint gyanús. 7/B. Senki se fogja vizsgálni ezt a kis funkció nélküli fehérjedarabot. Nincs értelme, de technikailag is nehezen kivitelezhető, így senki se fog bajlódni vele, mert nincs értelme. Ez a baj a valódi tudományokkal, így lesznek mindig előnyben a „szakmabeli” természetfilozófusok, mert nem lehet mindent kutatni, több ok miatt is. A gyakorlati tudás megszerzése rengeteg határba ütközik, de okoskodni könnyű. Kicsit más: az egyetemen én is sok mindent tanultam, biológus vagyok. Adott egy szép alaptudást. Amióta dolgozok, laborban, csinálom a doktorimat, azóta milliószor többet tudok, nem csak a szakterületemen, de úgy általában is. A gyakorlat nagyon sok mindenre rávilágít és ezzel a sok elméleti szakember és „szakember” nem rendelkezik.
    8) Minden ilyen evolúció ellenes/szkeptikus idézetre jut 10, ha nem 100 olyan, mely mellette szól. És jutna még milliónyi, ha az evolúciót gyakorlatban tanulmányozó és szó szerint használó biológusok (és itt minden biológusról beszélek, hisz az evolúció minden téren áthatja a biológiát) is ennyi időt töltenének a nagy mondások megfogalmazásával.

  • Szabados Ádám says:

    Kedves Lima Rui,

    1) Ha én – Szabados Ádám – azt mondom, hogy a paleontológia ellentmond a neo-darwinizmusnak, az más súllyal nyom a latban, mintha Louis Agassiz, Stephen Gay Gould vagy Géczy Barnabás mondja ugyanezt. Ők pedig – másokkal együtt – nyilván azért mondják ezt, mert rengeteg súlyos problémába ütköztek. A problémák felsorolása túlfeszítené egy komment kereteit, de a legfontosabb probléma köztudottan az, hogy a leletek nem tükrözik az életformák közötti fokozatos átmenet hipotézisét.

    2) Eleve azt feltételezed, hogy az ember fokozatosan alakult ki egy korábbi létformából, pedig éppen ezt kellene bizonyítani. A cikkben szereplő matematikai modell valóban megadott faktorokkal számol, de ezek nem rontják, inkább jelentősen növelik a neo-darwinista folyamatok reális esélyeit. Az inszerció hatásáról belinkelt tanulmány pedig azt támasztja alá, hogy a nem pontmutációk által sem jobbak az előnyös mutációk esélyei. A nyelv analógiája (mint egy másik funkcionális jelsor) talán megvilágítja a problémát: az információ nagy valószínűséggel romlik, amikor akár a betűk, akár a szavak szintjén véletlenszerű változást idézünk elő a szövegben.

    3) Ha kisebb alpopulációkat veszünk figyelembe, az nem csak úgy módosítja a számításokat, hogy az alacsony egyedszám miatt elég gyorsan el tud terjedni egy előnyös jelleg, hanem úgy is, hogy az (egyébként is rendkívül kis eséllyel megjelenő) esetleges előnyös mutációt a genetikai sodródás sokkal könnyebben elveszíti, hiszen egy kicsi populáció túlélési esélyei valószínűleg sokkal rosszabbak, mint egy nagyobb populációéi.

    4) Egyetértünk.

    5) A cikk csak (orvosi szempontból) előnytelen és neutrális változásokat említ. Ha találtak volna előnyös mutációt, feltételezem, hogy írtak volna róla.

    6) ?

    7) Azt látom gondnak, hogy az evolúciós szemüveg azonnal egymásból való átalakulást feltételez ott, ahol valamilyen hasonlóságot lát, pedig sokszor bebizonyosodott, hogy ez félrevezethet. 7B) Valószínűleg az a legjobb, ha a gyakorlati és az elméleti ismeret egyszerre van jelen. Az eredetelméletek olyan irányai a tudományos kutatásoknak, ahol az előfeltevéseknek és a nyomok összeillesztésének kulcsszerepük van, ezért a tágabb összefüggéseknek és a tudományfilozófiai kérdéseknek legalább akkora a szerepük, mint a konkrét kutatási projekteknek. A tudós, aki évtizedekig egy részterület tudományos projektjében vesz részt, sokszor alkalmatlanabb a tágabb összefüggések megválaszolására, mint az, aki éppen a tágabb összefüggések megválaszolásával tölti az idejét. Inkább az utóbbi fogja az előbbi tudását használni, mintsem fordítva.

    8) Az idézetek funkciója az volt, hogy hangsúlyozzam általuk: éles tudományos vita van, és a bizonyítás kényszere annak a vállát nyomja, aki állít valamit. A neo-darwinizmus súlyos állításokat tesz, de egyre inkább úgy tűnik, nem működik a modell.

  • Lima Rui says:

    Hosszú válaszra nincs időm, és nyaralni is megyek, de majd még visszatérünk a problémákra. Most csak egy kicsit foglalkoznék a 2) ponttal:
    Az ősi madaraknak, mint az Archaeopteryxnek és az Ichthyornisnak miért voltak fogai? És a mai madaraknál miért vannak embrionális korban duzzanataik a csőrükben és miért aktiválható náluk a fogképzés? Miért közösek a mai madarakban ezek a pszeudogének?
    http://criticalbiomass.blog.hu/2014/12/18/madarfogak_emlekei
    http://criticalbiomass.blog.hu/2006/02/27/re_madaraknak_fogsor
    http://criticalbiomass.blog.hu/2006/01/03/madaraknak_fogsor_csokeveny_szervek_2

    Bónusznak egy aprócska probléma:
    A családfádat vissza tudod vezetni egészen Ádás és Éváig? Nekem az ükapámról semmi információm nincs, és nem él olyan rokonom, aki ismerte volna őt. Nem beszélve az ő őseiről. Feltételezem léteztek, de ilyen erővel az is lehet, hogy a családfámat Isten vagy egy intelligencia teremtette a semmiből.

  • Szabados Ádám says:

    Kedves Lima Rui,

    szerintem ne menjünk végig az összes evolúcióval kapcsolatos kérdésen, csak ami szorosan kapcsolódik a cikk témájához, mert nekem sem lesz időm rá. A homológia és a csökevényes szervekből levezetett érv kezdettől fontos volt a darwinizmus számára, mégis itt vannak a legnagyobb kérdőjelek is, hiszen ma már tudjuk, hogy nagyon hasonló fiziológiai tulajdonságok időnként egészen más genetikai úton mutatkoznak meg, máskor meg nagyon hasonló genetikai bázisok egészen más tulajdonságokat produkálnak. A darwini paradigma előbbi esetben konvergens evolúcióról beszél, pedig teljesen hihetetlen a történet, hogy például a szem különböző utakon többször is kifejlődött (márpedig darwini alapon ezt kell feltételeznünk, ha a hasonló tulajdonságnak más a genetikai útja).

    Hogy miért van duzzanat embrionális korban a madarak csőrében? Fogalmam sincs. Lehet, hogy ekkora elaszticitás van a madarak genomjában, és potenciálisan képesek a fogképzésre, vagy esetleg valóban elcsökevényesedett szervről van szó. De az is lehet, hogy valamilyen még ismeretlen funkciója van ennek. (Az általad belinkelt cikkek is felvetnek kérdéseket, amikre még nincs válaszuk.) Homológ szervek és tulajdonságok más-más funkciót is elláthatnak, mi a kezünket például nem használjuk járáshoz, a fülünket nem használjuk legyezéshez, pedig hasonlít a majom kezéhez vagy az elefánt füléhez. Mi van, ha eleve más célra lettek megalkotva, noha hasonlít egymásra a szerkezetük, és a test hasonló helyén is találhatók? Teljesen jó tudományos projekt azt kutatni, hogy mi a funkciója az embriókorban megjelenő duzzanatnak, illetve hogy van-e kapcsolata a fogazat kialakulásához. Haeckel hamisított embriórajzai és a farokkal született gyermek szintén hamisított képei után, melyekből sokáig evolúciós ikonokat faragtak (tankönyvekben ma is szerepelnek), talán érthető, ha nem fogadom el elsőre azt a magyarázatot, hogy evolúciós csökevényekről van szó. Számos evolúciós csökevénynek hitt szervről derült már ki, hogy valójában fontos funkciót lát el. Simán lehet, hogy itt is elhamarkodott a következtetés, hogy a duzzanat evolúciós csökevény volna. A kalapácsos ember ugye mindent szögnek lát.

    A családfámat IV. Béla király idejéig tudom visszavezetni, de nyilván nem erre vonatkozott a kérdésed. Viszont nem egészen értem, mire.

  • Lima Rui says:

    http://criticalbiomass.blog.hu/2016/09/01/szor_toll_pikkely_plakod_variaciok_egy_temara
    http://criticalbiomass.blog.hu/2009/04/15/bolygo_idegek_es_az_evolucio
    Több konkrét példát nem hozok fel.
    Érdemes amúgy olvasgatni ezt a blogot. Van sok GMO témájú poszt is. Ahhoz hogyan állsz hozzá? Nem lesz cikk róla? (Beleavatkozás Isten munkájába. Újabb Bábel tornya.)

    A családfa úgy jön ide, hogy (legalábbis annak aki elhiszi az evolúciót) az élőlények családfája az emberi családfák extrapolálása, vissza a múltba. Ahogy a családi leszármazásokon, rokoni kapcsolatokon visszafelé lépkedsz generációról generációra úgy lesz egyre nagyobb a különbség. Lesznek egyénre jellemző SNP-k és lesznek családra jellemzőek is, minél közelebbi a rokon, annál több közös. Ha elég hosszan visszalépkedsz, akkor már annyi mutáció gyűlik fel, hogy másik fajról beszélhetünk. Persze ott már jóval többről van szó, mint SNP-k: kromoszóma-átrendeződések is, specifikus deléciók, inszerciók, transzpozonok, stb, minden olyasmi, amiről a cikkedben említett tanulmány csak szót ejt (már amelyikről ejt), de nem vette a modelljébe. (A válaszodban esetleg külön kitérhetnél erre, hogy nincs e igazam valamennyire, hogy hiányolom a nagyobb léptékű mutációk beleszámítását ezen modellbe.)
    Ez az egyik része. A másik, hogy gondolom nem feltételezed, hogy IV. Béla király idején élt rokonod volt az utolsó ősöd és őt az angyalok hozták le a Földre. Valószínűleg a honfoglaló magyarok közt, sőt az Európába vándorolt első Homo sapiens népesség között is volt ősöd, de erről nincs lelet vagy emlék. Ha pl Ötziről kiderülne, hogy egy távoli ősöd, akkor feltételezhető, hogy a közte és a IV. Béla korában élt rokonod közt is sorakozott ősök sora, mégsincs róluk lelet vagy bizonyíték. Az SNP analízis alapján még egy valószínűsíthető mutációs-rekombinációs történet is felvázolható lenne, ami pusztán hipotetikus lenne, de valószínűsíthető. Az evolúciós törzsfák leképezése is így történik, csupán az evolúció tagadói számára elképzelhetetlen, hogy kellően sok mikromutáció makromutációt eredményezhet. (A valószínűségszámítás alapján is akár, amit szívesen felhasználnak az evolúció ellen, de mellette már nem fogadják el. Nevezetesen azt, hogyha 1 a 100 millióhoz a pontmutációs ráta, akkor mindegyik nukleotid ugyanakkora eséllyel változik meg, így az is megtörténhet hogy egy szelvénnyel behúzod az ötös lottót, míg más 50 év alatt egyszer sem.)

  • Szabados Ádám says:

    Lima Rui,

    nem terveztem írni a GMO-ról és egyelőre nincs is igazán véleményem róla.:)

    A nagyobb léptékű mutációk (pl. inszerció által) hasonló matematikai problémákat vetnek fel, mint a pontmutációk. A génszekvenciák ugyanis – ahogy te is helyesen rámutattál – epigenetikai kontextusban értelmeződnek, és ez nem egyszerűsíti, hanem rendkívüli mértékben bonyolítja az információ funkcionális specifikusságát, növelve a matematikai problémákat. Másrészt az inszertálódott szekvencia valahol máshol össze kellett, hogy álljon, ami felveti ugyanazt a matematikai problémát, csak eggyel odébb tolja. Sanford egyébként kitért ezekre a kérdésekre ebben a cikkében.

    A családfákkal kapcsolatban szerintem nem azt tapasztaljuk, hogy visszafelé haladva a korban az ember természete annyira más lenne, mint ma. Sőt, a történelemtudomány egyik legalapvetőbb kiindulópontja az, hogy az emberi természetet a múltban is a mostanival azonosnak tekinti, különben nem tudna motivációkra következtetni. És ez nem is csak találgatás, hiszen például az írott emlékekből sokat tudunk a régiek gondolkozásáról és életéről. Bár a technológia kétségkívül sokat fejlődött az ókor óta, Szapphó és Anakreón verseit olvasva például egyértelmű, hogy az emberi természet nem változott, sőt, Homérosz és Aiszóposz írásaiban még az istenek és az állatok is (megszemélyesítve) pont olyanok, mint mi vagyunk. És akkor a Biblia vagy a legrégebbi mítoszok többezer éves alakjairól még nem is beszéltem. Arisztotelész logikája és poétikája a mai napig elképesztően időszerű.

    Te azt feltételezed, hogy a genom szinte a végtelenségig elasztikus és fejlődésre képes. Szerintem ezt nem igazolják a mikroevolúcióról szerzett valós idejű ismereteink (pl. Lenski E-coli kísérlete, a HIV-vírus mutációi, a P. falciparum klorokvin-rezisztenciájának kialakulása), vagyis azok a megfigyelések, amelyek révén a legtöbbet tudunk az evolúcióról. Ezek a megfigyelések kifejezetten csalódást okoznak azoknak, akik az evolúció potenciálját szinte határtalannak gondolják. Nagyon úgy tűnik, hogy az evolúciónak vannak határai, és ez nagyjából az, amikor két előnyös mutációra egyszerre van szükség. (Ajánlom a témában Michael Behe The Edge of Evolution c. könyvét, aminek fő következtetéseit azóta két független kutatás is igazolta. Itt írtam róla én is.)

    Ami meg a kezdetet illeti: hacsak valaki nem hisz abban, hogy ami van, az mindig is volt, akkor valahol el kellett kezdődnie a történetnek. És ha volt kezdet, akkor a valóság fizikai állandóit valaki meghatározta, mégpedig úgy, hogy az lehetővé tegye az életet. Valaki finomhangolta a világot az élet számára. Aztán valaki információt vitt az élettelen világba és létrejöttek az első élőlények. Aztán újabb és újabb body plan-ek jöttek létre, melyeket elképesztő mennyiségű komplex, funkcionálisan specifikus információ vezérel. Hogy hány alkalommal, mikor és hogyan került információ az élet rendszereibe, az szerintem legalább annyira izgalmas tudományos projekt, mint abból a hipotézisből kiindulva vizsgálni a valóságot, hogy minden egyetlen közös ősre vezethető vissza. A kambriumi robbanás az egyik olyan jelenség, amit még Darwin is az elmélete Achilles-sarkának tartott, és ma is ugyanazt a dilemmát veti fel, mint 150 éve. Szóval szerintem legitim tudományos kérdés, hogy mikor került az az információ az élet rendszereibe, amely miatt életről és biokomplexitásról beszélhetünk. A darwinizmusnak nem sikerült bebizonyítania, hogy ez az információ sztochasztikus folyamatok révén létrejöhetett, és minél többet tudunk a molekuláris biológiáról és az epigenetikáról, annál kevésbé tűnik plauzibilisnek ez a hipotézis.

  • Lima Rui says:

    “Nagyon úgy tűnik, hogy az evolúciónak vannak határai, és ez nagyjából az, amikor két előnyös mutációra egyszerre van szükség.”
    http://www.origo.hu/tudomany/20160726-bakteriumok-evolucio-mta-kutatas-termeszetes-szelekcio.html
    Az előadását is meghallgattam. Az egyik modelljükben 1 mutáció kellett egyféle tápanyag lebontásához, majd miután ezt megszerezte 1 másik mutációval képessé vált egy másik, bár hasonló tápanyag lebontására a baktérium. A 2 mutáció egyszerre valóban nem jelent meg, de nem is kellett. A biokémiai útvonalak sokszor átfednek, sok a közös enzim, van amelyik többféle reakciót is katalizálhat, bár másféle hatásfokkal, de ezt az expressziós szint változása is befolyásolhatja.
    “A nagyobb léptékű mutációk (pl. inszerció által) hasonló matematikai problémákat vetnek fel, mint a pontmutációk.” Lehet, de egy nagyobb léptékű mutáció egyszerre gének százait, ezreit is érintheti. Gyakran az egy biokémiai útvonalban résztvevő gének kapcsoltan helyezkednek el egy kromoszómán, így mindannyiukat érintheti pl egy kromoszóma átrendeződés. Egy transzkripciós faktor promóterében történő akár egyetlen pontmutáció megváltoztathatja az expressziós mintázatát, így megjelenhet olyan szövetben ahol eddig nem volt jelen és aktiválhat ott olyan fehérjéket, melyek addig nem voltak jelen.
    A harapással terjedő rák miatt a tasmán ördögök genomjának immunitásért, a rákkal való harcért felelős régiói gyorsabban evolválódnak, mint a többi, így lehet, hogy nem fognak kihalni. Ezt hívják evolúciónak. Amúgy lehet, hogy ez egy új, eddig nem ismert folyamat, hisz csupán 6 generációról van szó!
    http://sciencemeetup.444.hu/2016/09/10/szegeny-ordogok-ragalyos-rak-a-tasman-ordogben-es-mashol
    Antibiotikum rezisztencia megjelenése és elterjedése:
    http://criticalbiomass.blog.hu/2016/09/10/mega-plate
    A legtöbb független vonalban először olyan mutáció jelent meg, ami a hibajavítás hatékonyságát csökkentette, így felszaporodhattak a mutációk, felgyorsult az evolúció, hogy fennmaradhassanak. (Ezt már sokszor megfigyelték korábban is.)

  • Szabados Ádám says:

    Arról beszéltem, amikor két mutáció együttesen szükséges ahhoz, hogy előnyös legyen. Tudjuk, hogy a legtöbb mutáció önmagában hátrányos. Nem állítottam, hogy nincsenek mutáció általi változások, de tény, hogy a legtöbb mutáció – az előnyt jelentő is – más területen funkcióvesztéssel jár. Az evolúció tehát nem egyértelmű fejlődés akkor sem, amikor valamilyen tulajdonság (pl. antibiotikummal szembeni rezisztencia) kialakul. A megfigyelések nagyon távol állnak azoktól az innovációkról, amilyeneket a darwinizmus elmélete a múltban feltételez.

  • dzsaszper says:

    Lima Rui,

    a többszörös mutáció által okozott előnyről, a dolog működhet akkor, ha csak az egyik vagy csak a másik mutáció önmagában legalábbis lényegében neutrális…

    A gond elsősorban az, hogy emlékeim szerint vannak olyan ismert példák, amikor csak az egyik vagy csak a másik mutáció kifejezetten hátrányos és a mutált allél várhatóan nem él túl addig, amig beüt a másik mutáció…
    Nem vagyok biológus, túrnom kell majd a netet ilyen példáért…

  • Szabados Ádám says:

    A PfCRT klorokvin-rezisztenciája az egyik ismert példa. Minimum két mutáció együttesen kell ahhoz, hogy ez a rezisztencia kialakuljon, és a tapasztalatok azt mutatják, hogy a hatalmas populáció és gyors reprodukció ellenére nagyon lassan és csak kevés helyen bukkant fel a rezisztens mutáns. Kisebb és lassabban reprodukálódó populáció esetében a két mutáció együttes megjelenésének szükségessége már határa lehet az evolúciónak.

  • Lima Rui says:

    A PfCRT klorokvin-rezisztenciáját felhozni elég nagy öngól. Mint ahogy te is írtad legalább 2 mutáció szükséges (alacsonyfokú) rezisztencia kialakításához és ez meg is történt, nem kevesebb, mint 5-ször (a te linked: http://www.pnas.org/content/111/17/E1759.long ), ami le is fedi nagyrészt az érintett területeket, így minek is alakult volna ki többször, ha a rezisztens mutánsok gyorsan elterjedtek. Amúgy a hatékony rezisztenciához 4-10 mutáció szükséges és a különböző törzsek különböző úton fejlesztették ki ezeket, ráadásul a különböző térségekben eltérő kezelési stratégiákat alkalmaztak és ez befolyásolta a kialakult rezisztencia erősségét, tehát a különböző szelekciós kihívásokra különböző adaptációs utakkal reagáltak. Mellesleg ahogy a cikk is írja, ez a transzporter a leggyakoribb, de nem az egyetlen út rezisztencia kialakítására. Szóval: lehet, hogy statisztikailag kicsi az esélye, hogy egyszerre 2 mutáció alakuljon ki, de mint ahogy megfigyeltük ez elő is fordult, legalább 5-ször függetlenül. Szerintem ez épp a következtetéseddel ellentétes (az ugyan igaz, hogy nagy a parazita populációja, de ez térségenként eltérő, pl Pápuában jóval kisebb és itt is kialakult rezisztens variáns). Továbbá, és ez is nagyon fontos, a kísérletek hatékony klorokvin dózissal számolnak, de ez messze nem jelenti azt, hogy az érintettek közül mindenki tartotta az adagját. Tudjuk, hogy ez az antibiotikumoknál is nagy probléma. Így elég könnyen kialakulhat egy vonalban a 2 mutáció, főleg hogy már önmagában az egyik aminosav csere megváltoztatja a transzporter kémiai karakterisztikáját, így már ez is lehet adaptív előny alacsony dózisú klorokvin esetén (ezt nem vizsgálta a cikk, de elképzelhető lehet. És ami szintén fontos: egy mutáció is okozhat adaptív előnnyel járó fenotipikus változást, példa erre a rengeteg antibiotikum rezisztens baktérium törzs. És még valami, csak hogy mások is tisztában legyenek vele, bár ezt te sem állítottad: a linkelt maláriás cikk nem az evolúció ellen szól, igazából nem is érinti a témát, bár az eredmény egyértelműen ezt mutatja, hogy van evolúció, legalábbis mikroevolúció (bár ez a fogalom, a „mikro” előtaggal, eleve csak az evo-antievo vitákban merül fel). Ez a vizsgálat eleve nem alkalmas az evo tagadására, ugyanis a klorokvin és minden más hatékony antimikrobiális szer lényege, hogy helyes alkalmazás mellett esélyt se adjon a kórokozónak rezisztencia kialakítására. A természetben a körülmények nem feltétlenül ilyenek, de ha mégis, akkor bizony kihal a faj, ilyen már előfordult, ezt senki se vitatja, sőt, ez is az evo mellett szóló érv, hisz nem minden faj bírja a versenyt. (Ellenben a megtervezett fajoknál ez tervezési hibát jelent, ami nem fér össze a felsőbbrendű intelligenciával. Persze, lehetett ez a célja. De minek? Azt nem tudhatjuk.) Ennek ellenére a malária mégis bírta a versenyt.

  • Szabados Ádám says:

    Miért lenne öngól? Nem azt mondtam, hogy a PfCRT nem alakított ki rezisztenciát, hanem azt, hogy ez még egy ilyen nagy populációjú és gyorsan reprodukálódó élőlény esetében is csak nagyon hosszú idő alatt alakult ki. Az öt nem sok, hanem rendkívül kevés, tekintve hogy az evolúciónak sokkal nagyobb feladatai is lennének, mégis egy ilyen apró előnyös módosulást is alig tudott kiizzadni magából. Ráadásul évtizedek alatt. A két mutáció együttes megjelenése kis populációjú és lassan reprodukálódó fajok esetében könnyen lehet, hogy már megugorhatatlan. A PfCRT klorokvin-rezisztenciája ráadásul más területen funkcióvesztéssel is együtt járt, a védelem úgy alakult ki a sejtben, mint mikor egy háborúban hidat robbantanak fel. Bár a klorokvinra rezisztens lett a parazita, a sejtben roncsolás történt, nem fejlődés. Ajánlom a témában a biokémikus M. Behe The Edge of Evolution c. könyvét.

  • Lima Rui says:

    Az a baj, ha sok érvet hozok fel, akkor egy részére nem kapok választ.
    És ha funkcióvesztéssel járt? Senki se állította, hogy ilyen nem lehet. A természetben az erőforrások és a lehetőségek korlátosak, van hogy le kell mondani dolgokról. Az emberi élet is ilyen. Mondok egy példát is: a hibajavítás. Az eukariótákban egy nagyságrenddel hatékonyabb, mint a baktériumokban. És ez nem véletlen. A baktériumok jóval gyorsabban szaporodnak, jóval kisebb erőforrás ráfordítással, így a hibajavítási idő redukálásával többet nyernek, mit vesztenek. Lehet, hogy 10-szer több sejt pusztul el, de 100-szor több keletkezik. Valójában az eukariótáknál a hibajavítás növekedése egy funkciónyerés volt, de elvesztették a gyors reprodukciót vele, ami egyértelműen funkcióvesztés. De egyéb tulajdonságaiknak köszönhetően, elsősorban a sejtváznak, képesek voltak többsejtű élőlényekké szerveződni, ahol viszont az összetett élőlénynek már előnyére vált a hibajavítás és a lassabb, de jobban kontrollált sejtosztódás (ugye, ennek a hibája a rák). A további, többsejtűségből eredő tulajdonságoknak, pl a megnövekedett testméretnek és a specializált sejteknek köszönhető plusz funkciók miatt további előnyökre tettek szert, így a lassabb sejtosztódás se volt már hátrány.
    A hibajavítás lehetne még jobb, akár szinte tökéletes is, de akkor az evolúció annyira lelassulna, hogy ez a fejlődési vonal lemaradna. Valószínűleg elő is fordult ilyen, de kihaltak. Így viszont az evolúció ára a rák. Ezt amúgy meg lehetne oldani úgy, ha pl az ivarssejtek kialakulásakor aktiválódó polimeráz rendelkezne a mostani hatékonyságával, de a kellően fejlett magzatban már egy sokkal pontosabb polimeráz aktiválódna, sokkal alaposabb hibajavítással. Ezt egy Tervező megoldotta volna.

  • Szabados Ádám says:

    Az a baj, ha sok érvet hozok fel, akkor egy részére nem kapok választ.

    Próbáltam minden olyan ellenvetésedre válaszolni, amit relevánsnak tartottam, és amire a korlátozott tudásom alapján válaszolni tudtam. Ahogy más biológusok, genetikusok és biokémikusok érveire odafigyelek, a te érveidre is odafigyeltem, de nyugodtan mutass rá arra a gondolatodra, amire választ vársz tőlem. Ha az egyszeres mutációk általi előnyös változásokról szóló példáidra gondolsz, azokra azért nem válaszoltam, mert az én érvem a két előnyös mutáció egyszerre megjelenéséről szólt, és nyilvánvaló, hogy számos előnyt jelentő változáshoz minimum két mutáció kell egyszerre. Erre volt példám a klorokvin-rezisztencia kialakulása, amihez egy mutáció kevés lett volna, a kettő pedig csak nagyon-nagyon lassan alakult ki.

    Valójában az eukariótáknál a hibajavítás növekedése egy funkciónyerés volt, de elvesztették a gyors reprodukciót vele, ami egyértelműen funkcióvesztés. De egyéb tulajdonságaiknak köszönhetően, elsősorban a sejtváznak, képesek voltak többsejtű élőlényekké szerveződni, ahol viszont az összetett élőlénynek már előnyére vált a hibajavítás és a lassabb, de jobban kontrollált sejtosztódás (ugye, ennek a hibája a rák). A további, többsejtűségből eredő tulajdonságoknak, pl a megnövekedett testméretnek és a specializált sejteknek köszönhető plusz funkciók miatt további előnyökre tettek szert, így a lassabb sejtosztódás se volt már hátrány.

    Ez az evolúciós narratíva. Tudsz olyan kísérletről vagy megfigyelésről, ahol ez ténylegesen végbement?

    A hibajavítás lehetne még jobb, akár szinte tökéletes is, de akkor az evolúció annyira lelassulna, hogy ez a fejlődési vonal lemaradna. (…) Ezt egy Tervező megoldotta volna.

    Hadd fordítsam visszájára a gondolatodat. Érdekes, hogy ha az evolúció annyi mindent megoldott (pl. felépített olyan lenyűgöző információ-vezérelt rendszereket, amilyenekre még Bill Gates is azt mondta, hogy emberi intelligencia eddig nem volt képes megalkotni), ezt pont miért nem oldotta meg. De az iróniát félretéve, olyan az érved, mintha egy rosszul nyomtatott oldal miatt az írótól a szoftver-fejlesztőig minden intelligens kreativitást és tervezést megkérdőjeleznél az adott könyv kapcsán. Az, hogy egy teremtett világban miért van rák, fontos teológiai kérdés, amire a teológiának van is válasza, de én eddig a tudomány oldaláról közelítettem a cikk témájához.

  • Lima Rui says:

    Egy érdekes cikk arról, hogy a hátrányos mutáció kifejezés nem mindig értelmezhető, hisz gyakran egy-egy génnek csak bizonyos környezetben van szerepe, így ha egy másféle környezet állandósul generációk ezreire, akkor el is veszhetnek ezek a gének és növelve az életképességet, hisz nőhet az energiahatékonyság, ezek a mutációk fixálódhatnak a populációban.
    http://journals.plos.org/plosgenetics/article?id=10.1371%2Fjournal.pgen.1002787
    „Gene loss by deletion is a common evolutionary process in bacteria, as exemplified by bacteria with small genomes that have evolved from bacteria with larger genomes by reductive processes… In the bacterium Salmonella enterica, we measured deletion rates at 11 chromosomal positions and the fitness effects of several spontaneous deletions. Approximately 25% of the examined deletions caused an increase in fitness under one or several growth conditions, and after serial passage of wild-type bacteria in rich medium for 1,000 generations we observed fixation of deletions that substantially increased bacterial fitness when reconstructed in a non-evolved bacterium. These results suggest that selection could be a significant driver of gene loss and reductive genome evolution… when Salmonella is grown for many generations in a rich growth medium, fitness-increasing deletions accumulate in the population. Our results suggest that selection as well as non-adaptive processes might drive genome reduction and that for certain chromosomal regions gene loss may occur by a rapid adaptive process… The isolated deletions ranged in size from 2–67 kbp… Since most of the deletions remove several genes (many of which have no assigned function) it is difficult to explain why a specific deletion will have a beneficial, neutral or deleterious effect on fitness. With regard to the beneficial deletions, one potential explanation is that loss of these genes result in decreased energy/mass expenditure on DNA, RNA and protein and a resulting faster growth rate because more resources can be allocated to other rate-limiting processes. This idea has previously been explored by in several studies where the effects on growth rate by specific mutations in anabolic/catabolic operons were examined… It is notable that the calculated expected cost of running flagella is 4.5% of the cells total energy expenditure, which corresponds well with the 3.2% fitness increase observed in the non-motile fliG deletion mutant.”
    A természetben persze a környezet, az életközösség folyamatosan változik, ezért maradhatnak meg olyan gének, melyek feleslegesnek tűnhetnek. Viszont ezek a gének ezekben a környezetben elveszhettek, fitness nyereséget okozva a baktériumnak.
    Egy másik érdekesség: egy verzió arra, hogyan alakulhatott ki a többsejtűség, ráadásul ez is evolúciós kísérlet. Habár a többsejtű Chlorella kolónia egyes sejtjeit kevesebb fény éri és így lassabban növekednek, de ez a szerveződés megvédi őket a ragadozótól. Ragadozó hiányában az egysejtű algák viszont túlnövik a telepeket.

  • dzsaszper says:

    Kedves Lima Rui,

    nem értem, hogy a PLOS Genetics cikk hivatkozásával mi mellett szerettél volna érvelni.

  • Lima Rui says:

    Valóban nem pontosan a kérdésre válaszoltam, oda is akartam írni. Viszont amellett érvelek, hogy a hátrányos mutációk egy része nem minden környezetben hátrányos és az evolúció hajtóereje lehet. Az evolúció ellen az egyik fő érv, hogy a mutációknak nagyon kis része előnyös. Itt van 2 példa rá (illetve a PlosOne cikkben sok példa), hogy ez nem feltétlenül gond. És konkrétan evolúció zajlik ezekben a kísérletekben. Nem lesz egyik fajból más faj, de tudjuk, hogy a “faj” mesterséges fogalom, nem lehet éles határvonalat húzni. Ez egy folyamatos változás, ami csak akkor látszik ha 2 távoli pontjáról választunk egy-egy egyedet, akkor mondhatjuk el, hogy már más fajról van szó. A kísértelek attól még az evolúciót mutatják be, bizonyítják mutációk, akár (bizonyos helyzetben) hátrányos mutációk fixálódását a populációban.

  • Lima Rui says:

    Továbbá a mutáció fixálódása populáció szinten 1000 generáció alatt lezajlik, ráadásul nem csak előidézett, hanem spontán mutációkról is szó van, ami ténylegesen bizonyítja a cikkben tárgyalt matematikai modell tévedését.

  • dzsaszper says:

    Amennyire értelek, egy ellenérv ellen érvelsz, a hátrányosan mutált de később más mutációval előnyössé váló allélek fennmaradási esélyeit illetően.

  • Szabados Ádám says:

    Lima Rui,

    1) A Chlorella kolóniák kialakulásáról belinkelt cikk nem azt mondja el, hogy a megfigyelt kísérletben hogyan alakultak ki egysejtűből többsejtűek, hanem csak azt, hogy talán a kolóniák kialakulásán keresztül megérthetjük, hogyan alakulhattak ki többsejtű élőlények (a cím is az, hogy “A potential origin of multicellularity”). Nem bizonyíték, hanem fiktív extrapoláció.

    2) A mutációk fixálódását a fent említett matematikai modell is figyelembe veszi, szó sincs tévedésről. Az 1000 generáció viszont egy hominida populáció esetében nagyon hosszú idő, hiszen ha 20 év a reprodukálódás, akkor egyetlen mutáció fixálódása 20 ezer évet jelent. És akkor még nem is beszéltünk arról, hogy annak a bizonyos előnyös mutációnak meg kell jelennie, ami már csak azért is komoly dilemma, mert az Exome Aggrevation Corsortium friss tanulmánya 60000 ember 1.2 milliárd mutációja között egyetlen előnyös mutációt sem talált.

    3) A szelektív előnyt nyújtó mutációk megfigyelt példáinál (pl. Lenski E-Coli kísérlete, a HIV vírus mutálódása, a PfCRT klorokvin-rezisztenciájának kialakulása, az antibakteriális MEGA-plate kísérlet) az a tendencia látható, hogy a szelekciós előnyt jelentő mutáció más tekintetben devolúció, mert gének romlásával és funkcióvesztéssel jár. Ez azért lehangoló, mert az evolúciónak egészen elképesztő rendszereket kellene felépítenie, amit megfigyelünk, az viszont inkább ahhoz hasonlít, mint amikor egy ház szellőzését úgy oldják meg, hogy kitörik az ablakokat, vagy egy autót úgy tesznek gyorsabbá, hogy kiszedik az üléseit és leszedik a sárhányóit, hogy könnyebb legyen. Ez nem építkezés, hanem rombolás és információvesztés.

  • Lima Rui says:

    Nem. Egy darab mutációról beszélek, mely A környezetben lehet hátrány, de B környezetben lehet előny. Ha a B környezet állandósul, akkor a mutáció is rögzül, pedig mondjuk egy vagy több gén elvesztése általában hátrány. Ha visszatér tartósan az A környezet, akkor kihalhat a faj. A legtöbb példa esetében a gén vagy gének elvesztésével az előny kimerül az energiatakarékosságban, ami nem elhanyagolható, hiszen a lehetőséges korlátosak a természetben. Egy ismert példa a heterozigóta sarlóssejtes vérszegények védettsége a malária ellen, pedig ez a betegség még a heterozigótáknak is jelentősen csökkenti a fitneszét, de nem annyira mint a malária.
    Írok egy egyszerű példát, a kutatási területemről. A Rhizobium talajlakó baktériumok közül sok törzs képes szimbiózist kialakítani hüvelyes növényekkel, pl bab, borsó. A 6500 génje közül 1000 darab egy megaplazmidon található, mely a szimbiózishoz köthető. Ezen gének jelentős része csak akkor aktiválódik, ha a baktérium megfertőzi a növényt és kialakul a nitrogonfixáló szimbiózis, ugyanis ennek a kapcsolatnak a kiépítése, fenntartása és a nitrogén megkötése a gének feladata. A talajlakó példányoknak felesleges teher az 1000 gén, igaz, nem expresszálnak, de a megaplazmid replikációja energiaigényes. Viszont a szimbiózis kialakításához elengedhetetlenek, és az egy tápanyagban gazdag, ellenségtől és kompetítortól védett környezetet biztosít a növény gyökérgümőjében. Ha viszont van elég nitrogén a talajban, akkor nem alakul ki szimbiózis, a bacik hiába tartják fent ezt az 1000 gént akár generációkig, ráadásul a többi, nem szimbiotikus Rhizobium és egyéb baci előnyt élvez. De ha elfogy a nitrogén, akkor kialakul egy új niche és a szimbiotikus baktériumok robbanásszerűen elszaporodnak ott, majd a gümő lebomlásakor már jóval nagyobb mennyiségben kerülnek vissza a talajba.
    (Mellesleg a szimbiotikus megaplazmidnak is van evolúciós története, hisz van egy több tucat gént tartalmazó régiója, ami sok Rhizobiumban a kromoszóma része, míg az filogenetikailag újabb törzsekben ez transzlokálódott a szimbiotikus megaplazmidra. Nem véletlenül, hisz hatékonyabb a szimbiózis regulációja, ha az érintett gének egy helyen, együtt expresszálnak, közös szabályzás alatt.)
    A példáim arra akarnak rávilágítani, hogy sok ún hátrányos mutáció csak adott környezetben hátrányos, máshol előnyös lehet. Ugyanazon mutációról beszélek, nem arról, hogy erre később más mutációk rárakódnak, komplementálják.A PlosGenetics cikkből kiemeltem ezt a részt: “It is notable that the calculated expected cost of running flagella is 4.5% of the cells total energy expenditure, which corresponds well with the 3.2% fitness increase observed in the non-motile fliG deletion mutant.” Az idézet valóban nem teljes. Szóval az egyik mutáns törzs elvesztette a fliG génjét, így nincs flagelluma. Emiatt a mozgása nagyon korlátozott, de a kísérleti körülmények közt, gazdag táptalajban, ragadozók nélkül ez neki nem hátrány, viszont megspórol vele rengeteg energiát, tehát nő a fitnesze. Ha más környezetbe kerülne, ahol úszni is kell a táplálékért, ott már hátrányba kerülne a flagellummal rendelkező törzsekkel szemben és kihalna. Ez hasonló, mint ami a barlangban vakká váló fajoknál történik. A szem elvesztése hatalmas hátrány lenne, ha nem vaksötétben élnének.
    Eddig a hátrányos mutációkról beszéltem, de ne felejtsük el, hogy bőven alakulnak ki előnyös mutációk is, nem kell feltétlenül 2 mutáció megléte, és hamar elterjednek a populációban, példa erre a tasmán ördög védettsége a fertőző rák ellen (és ez nem is nagy populáció!!), illetve a HIV rezisztens afrikaiak számának növekedése. A tasmán ördögök esetében amúgy nem lepődnék meg ha szó lenne egy eddig nem ismert mechanizmusról, ugyanis csupán 6 generáció elég volt ahhoz, hogy kialakuljanak és elterjedjenek a rezisztens egyedek, illetve amelyekben a rák nem halálos és egy konszolidált formává alakulhat át, mint a kutyák esetében (ko-evolúció).

  • Lima Rui says:

    “És akkor még nem is beszéltünk arról, hogy annak a bizonyos előnyös mutációnak meg kell jelennie, ami már csak azért is komoly dilemma, mert az Exome Aggrevation Corsortium friss tanulmánya 60000 ember 1.2 milliárd mutációja között egyetlen előnyös mutációt sem talált.”
    Légyszíves, másold be ezt a szakaszt, én nem találom.
    Kíváncsi lennék, hogyan állapítanák meg a 60 ezer ember 1,2 milliárd mutációjáról, hogy előnyös e. Persze a fehérjekódoló régióban egy samasense mutáció az neutrális, ez könnyű. Ismert genetikai betegségeknél is egyértelmű. De nem hiszem, hogy mind az 1,2 milliárd mutációról tudják, hogy az aminosav csere vagy a nem kódoló szekvenciában történő változás előnyös vagy hátrányos e. Rengeteg génünk funkciója nem ismert. Továbbá, ahogy eddig is kifejtettem, sok mutáció előnye vagy hátránya vagy neutrális volta környezetfüggő. Modellezni esetleg lehet, főleg fehérjéknél. Megtették mindegyik mutációnál?

  • Szabados Ádám says:

    Korábban is válaszoltam már erre: a tanulmány nem említ egyetlen előnyös mutációt sem, csak neutrális és hátrányos mutációt, pedig ha találtak volna, nyilvánvalóan szót ejtettek volna róla. Itt van két idézet, amelyből ez látszik:

    “Large-scale reference data sets of human genetic variation are critical for the medical and functional interpretation of DNA sequence changes. Here we describe the aggregation and analysis of high-quality exome (protein-coding region) DNA sequence data for 60,706 individuals of diverse ancestries generated as part of the Exome Aggregation Consortium (ExAC). This catalogue of human genetic diversity contains an average of one variant every eight bases of the exome, and provides direct evidence for the presence of widespread mutational recurrence. We have used this catalogue to calculate objective metrics of pathogenicity for sequence variants, and to identify genes subject to strong selection against various classes of mutation; identifying 3,230 genes with near-complete depletion of predicted protein-truncating variants, with 72% of these genes having no currently established human disease phenotype. Finally, we demonstrate that these data can be used for the efficient filtering of candidate disease-causing variants, and for the discovery of human ‘knockout’ variants in protein-coding genes. ”

    “More than half of the approximately 7.5 million variants found by ExAC are seen only once. But collectively, they occur at a remarkably high density — at one out of every eight sites in the exome. For each gene, the authors contrasted the expected and observed numbers of variants that cause the production of truncated proteins, to search for regions containing lower-than-predicted levels of protein-truncating variants. This allowed them to identify several thousand genes that are highly sensitive to such variants — that is, unable to function normally after loss of one copy of the gene, even if the other copy is intact. Most of these genes have not yet been associated with disease, but mutation probably leads to embryonic death or strongly affects fitness in some other way. These genes are also intolerant of variants in regulatory DNA sequences that markedly alter levels of RNA synthesis from the gene, and are more likely than other genes to be implicated in genome-wide association studies of common disease.”

    Ha egy mutáció előnye valamelyest környezetfüggő is, az sem változtat azon a tényen, hogy a szelekciós előny információvesztéssel alakult ki, vagyis a megfigyelt mikroevolúciós esemény nem példázza azt a lenyűgöző építkezési folyamatot, amit a neo-darwinista teória vizionál. Éppen ellenkezőleg.

  • Lima Rui says:

    Több fontos pont felett is átsiklottál az Exome Aggrevation Corsortium tanulmányának olvasása közben. Pedig párat ki is másoltál ide.
    „Here we describe the aggregation and analysis of high-quality exome (protein-coding region) DNA sequence data” Tehát csak az exonokat vizsgálták, ami kb 30 millió bp, tehát a humán genom 1%-a! A fehérjekódoló régiók sokkal érzékenyebbek a mutációkra, ugyanis már 1-1 nukleotid inszerciója vagy deléciója frame-shiftet okoz, így a gén értelmetlen vagy részben értelmetlen fehérjét kódol. Természetéből fakadóan ez a fajta mutáció szinte biztos, hogy negatív hatású. A nem kódoló régiókban, tehát a genomunk 99%-ában ez nagyságrendekkel kevesebb problémát okoz, hisz a promóterek, intronok, UTR-ek inkább fehérje (TF) kötőhelyeket tartalmazhatnak vagy egyéb kis szekvenciákat (pl az exon-intron határ csupán 2-2 nukleotid nagyságú), szignálokat, melyek az egyenként több száz vagy ezer bázisból csak pár tucatnyit fednek le, így az esélye, hogy ezeket inszerció/deléció csak akkor rontja el, ha pont azt a szakaszt érinti. A genomunk 44%-a transzpozon, melyből kevesebb, mint 0,05% aktív. Ettől még lehet funkciója a többi 43,95% egy részének is (bár szerinted az összesnek), de az többnyire kimerül abban, hogy az inszerciójával módosítja gének expresszióját. Így ezekben az esetekben ritkán számít, ha mutáció történik ezekben a régiókban, tehát a genomunk legkevesebb 40%-áról van szó. Az élőlények genomjait tanulmányozva láthatjuk, hogy a nem kódoló szakaszok nagyságrendekkel több mutációt hordoznak, mint a kódolók. Konkrétan az általam tanulmányozott gén 2 paralógjának a kódoló régiója fehérje szinten 86%-ban, nukleotid szinten 82%-ban egyezik (tehát az exonok), míg a 2 teljes kódoló régió, exonok + intronok, de UTR nélkül (természetesen nukleotid szinten) csak 45%-ban. És azonos funkciójú a 2 paralóg, csak más az expressziójuk (a promóterek 47%-ban egyeznek). Mellesleg a génnek minden eukariótában van 1 vagy 2 ortológja, mind ugyanazzal a funkcióval, hisz erősen konzervált funkciójú génről van szó. A katalitikus domén 6 aminosavából 5 minden eukariótában egyforma, de a Drosophila és lucerna fehérje csak 43%-ban azonos (persze nem csak a katalitikus domén fontos a fehérje működéséhez). Látható a számaim alapján (és ez minden génre elmondható amúgy), hogy az exonok jóval kevesebb mutációt bírnak el, mint az intronok, de kellően sok idő alatt az exonokban is felhalmozódhat elegendő mutáció, amíg azok nem befolyásolják a fehérje működését. (Meg persze egy fehérje sosem önmagában működik, így együtt evolválódik a partnereivel.) Ezért lehet pl ez az eset: A glifozát gyomirtószer blokkolja a növények EPSPS enzimjét, de a bakteriális verzióhoz nem tud kötődni, ezért a glifozát-rezisztens GMO növényekbe belerakják a bakteriális EPSPS gént. A 2 ortológnak nagyon eltérő a szekvenciája, de a fehérje ugyanazt csinálja, habár a 2 ortológ már 3 milliárd éve elvált egymástól, mégis képesek egymást teljesen komplementálni (helyettesíteni). Itt felmerülhet sokakban a (költői) kérdés, hogy miért tervezett a Tervező egy génből annyi verziót ahány faj van, ha ugyanazt csinálja mindegyik? Ráadásul a gének homológiájának mértéke egyenesen összefügg a fajok rokonsági helyzetével. Az evolúciós elmélettel a válasz szépen levezethető. Egy intelligens Tervezőnél max az adu ászt lehet kirakni: Isten útjai kifürkészhetetlenek. Az a zseniális ebben a válaszban (és rokonaiban), hogy akár igaz is lehet, senki se tudja cáfolni.
    Kicsit elkalandoztam az eredeti problémától, azaz hogyan értelmezed az ExAC tanulmányt. (És ez nem a tanulmány kritikája, hanem a konklúziódé.)
    Szóval a genom azon 1%-át nézték csak, ami kevéssé van kitéve a mutáció fennmaradásának (nem magának a mutációnak, de ha az 1%-ban történik mutáció akkor a mutánsak jóval nagyobb arányban csökkene a fitnesze).
    „ identifying 3,230 genes with near-complete depletion of predicted protein-truncating variants” Ez a 3230 gén az emberi gének kb 16%-a. Ez a 3230 gén nem véletlenszerűen lett kiválogatva, hanem azért mert loss of function-intoleránsak, nagyrészt azért mert 1 normális kópia (a 2 –ből, hisz az ember diploid szervezet) nem elég belőlük (vagy mert 1 gén nem expresszál elég fehérjét vagy mert hiába jó a fehérjék fele, ha a másik felének torz a szerkezete a mutáció miatt, ezért a dimér vagy polimér nem elsz működőképes). „with 72% of these genes having no currently established human disease phenotype” Tehát vagy még nem azonosították, vagy komplementálja egy másik, jól működő gén. Fontos, hogy ezek a fehérjék nem tolerálják azt, ha csak 1 kópia helyes, tehát a gént érintő mutáció domináns. A domináns betegségek ritkán maradnak fenn. Viszont ezen gének közül sokaknál az is loss of function ha a fehérje más, esetleg „jobb” térszerkezetet vesz fel a mutáció miatt, hisz így se tud a „jobb” mutáns fehérje dimért vagy polimért képezni a másik kópiáról expresszálódó vad típusú fehérjével. (Ha tud, akkor persze fentmaradhat. De ha kompatibilisek egymással az azt jelenti, hogy nem jelentős a térszerkezet módosulása, tehát nem pozitív, hanem neutrális mutációról van szó.) „This allowed them to identify several thousand genes that are highly sensitive to such variants — that is, unable to function normally after loss of one copy of the gene, even if the other copy is intact.” Tehát a fehérje működési mechanizmusa miatt nem tudnak a pozitív mutációk fennmaradni. Persze ettől még lehet több allélje ezeknek a géneknek, hisz írja is „corresponding to one variant for every 8 base pairs (bp) within the exome intervals. „ de ettől még nem feltétlenül módosul a fehérje fenotípusa, hisz a fehérjéknek nem minden aminosava fontos, se a funkció(k)hoz, se a struktúra kialakításához, se a lokalizációhoz. Ilyen felesleges aminosavak minden fehérjén vannak, főleg a C-terminálison, de ez nagyban függ a fehérjétől. (De miért vannak? Hacsaknem evolúciós hordalék. Vagy Isten útjai kifürkészhetetlenek.) Viszont nem győzöm elégszer hangsúlyozni, hogy a szóban forgó 3230 gén nem tűri a fenotipikus változást, semmilyen irányba, se negatív, se pozitív irányba, bár persze előfordulhat még ettől, csak jóval ritkábban (és akkor ugye még rögzülnie is kell).
    „a tanulmány nem említ egyetlen előnyös mutációt sem, csak neutrális és hátrányos mutációt, pedig ha találtak volna, nyilvánvalóan szót ejtettek volna róla. „ Az eddigiek fényében ez helytelen következtetés. Nem véletlen, hogy a cikk ilyet még csak nem is sejtet.

  • Szabados Ádám says:

    Lima Rui,

    próbálom megérteni, hogy miről is akarsz engem meggyőzni. Két dologra gondolok, de javíts ki, ha rosszul értelek.

    Egyrészt arról próbálsz meggyőzni, hogy az ExAC tanulmányból helytelen arra következtetni, hogy nem találtak a vizsgált génekben előnyös mutációt. Azt készséggel elismerem, hogy a tanulmány nem zárja le a kérdést, hogy lehetnek-e előnyös mutációk az emberi genomban. Az viszont tény, hogy a tanulmány a vizsgált exonok kapcsán említ neutrális és lethális mutációt, előnyöset vagy fitness értéket növelőt azonban tudtommal nem. És ez fontos, új empirikus adat, ami mellé nem tudunk egyelőre más empirikus vizsgálatot odatenni.

    Másrészt arról próbálsz meggyőzni, hogy a Teremtő (ha lenne) nem úgy alakította volna a genom szerkezetét, ahogy azt találjuk, ellenben az evolúció kiváló magyarázat a jelenségekre. Csakhogy túl azon, hogy a teológiai érved problémás, talán észre sem veszed, de folyamatosan premisszaként használod az evolúciós narratívát a következtetéseidhez. Ez érvelési hiba. A kladisztikát nem lehet a neo-darwinizmus alátámasztására használni, hiszen eleve darwinista előfeltevésekkel dolgozik. A fenti matematikai modell pedig éppen a neo-darwinista narratíva mellé tesz kérdőjelet.

  • Lima Rui says:

    Az első pontot jól látod, azzal a kiegészítéssel, hogy a vizsgált géneknél a természetükből fakadóan nem is nagyon találhatnak pozitív mutációt, ezt fejtettem ki bőségesen. Ezért nem is alkalmas ez a cikk az álláspontod támogatására. A másik az, erről korábban írtam, hogy hogyan döntöd el egy mutációról, hogy pozitív? Azt sokkal nehezebb vizsgálni. Pl. egy enzim hatásfoka 10%-al nő, és így energiát spórolsz meg. Ezt szerinted vizsgálják egy embernél? És hogyan? Főleg hogy a hatásfok növekledést nem tudják előre, ráadásul nem is feltétlenül igaz minden célpontra, Ez a kutatás rengeteg időt és pénzt felemészteni, kevés eredményért. A tanulmány ezért se térhetett volna ki pozitív mutációkra (de fontosabb az első pont).
    Ami a második részt illeti: felsoroltam több genetikai problémát, mely logikailag nem fér össze egy intelligens Tervezővel, de az evolúciós narratívával összhangban van. Mi ezzel a baj? Teológiai érvem nem volt, csupán kíváncsi lennék, hogy azon kívül hogy “nem tudhatjuk” mi lehetne még érv, hogy mi értelme lenne ennek. De ezek csak költői kérdések voltak, írtam is egyszer. De azért elgondolkodtató, nem? Ha te terveznél élőlényeket, akkor nem így csinálnád, nem igaz?

  • Lima Rui says:

    A kladisztikát a tapasztalatok és tények alapján alakítják ki. Önmagában nem bizonyíték az evolúcióra, csak egybevág azzal. Természetesen úgy is létrejöhetett, hogy a Tervező már előzőleg megalkotott élőlényeket használt modellként az újakhoz. Ennél a magyarázatnál viszont problémás az, hogy gyakorlatilag minden ortológ különbözik egymástól. Nincs értelme nukleinsav módosításokat bevinni kódoló szakaszba, ha aztán nem módosul az aminosav összetétel. Vagy ha úgy módosul az aminosav összetétel, hogy annak nincs hatása a fehérjére vagy a funkcióra. Az evolúció erre ad magyarázatot, a tervezés viszont nem, hacsaknem azt, hogy mert megtehette vagy így volt kedve vagy hogy szívassa a biológusokat. A te érved az, hogy nem tudhatjuk, mivel nem teljes az ismeretünk, így lehet ennek általunk nem ismert értelme. Jól gondolom? Mert akkor igazából kár is kutatni és leragadhatunk a lábunk alatti kavics elemzésénél évezredekre. Vajon azt se a folyók csiszolták, hiába van egy ősi folyómederben, hanem a Tervező formálta ilyenné direkt? (Gondolom a válaszodra főleg erre fogsz kitérni, de azért az előzőekre is kíváncsi lennék: “Ha te terveznél élőlényeket, akkor nem így csinálnád, nem igaz?” “Nincs értelme nukleinsav módosításokat bevinni kódoló szakaszba, ha aztán nem módosul az aminosav összetétel.”)

  • Szabados Ádám says:

    A tanulmány számára nagyon fontos, hogy a mutációknak milyen élettani hatásuk van, ezt már az absztrakt is kimondja: “Large-scale reference data sets of human genetic variation are critical for the medical and functional interpretation of DNA sequence changes.” Tehát egyáltalán nem mindegy, hogy a neutrális, lethális, előnyös és előnytelen mutációkról mit találtak. Nyilván a tanulmány orvostudományi haszna miatt is tudtak forrásokat szerezni egy ekkora volumenű kutatásra (több mint 60 ezer ember génállományáról beszélünk).

    Azért problémás az érvelésed, mert eleve azt feltételezed, hogy az egyik faj a másikból alakult ki, a legkomplexebb élet is LUCA szülöttje, és ezt az érvelésedben is használod, holott éppen ez az, amit bizonyítani kellene, és amivel szemben rengeteg tudományos alapú kétely van. Tehát amikor például olyat mondasz, hogy „a 2 ortológ már 3 milliárd éve elvált egymástól”, feltételezed azt, amit bizonyítani akarsz.

    Az élet és a biokomplexitás létrejötte ma is ugyanolyan nagy kérdés, mint kétszáz évvel ezelőtt. A neo-darwinista paradigma a legtöbb esetben ugyanúgy nem tud a hogyanról mit mondani, mint az a paradigma, amely intelligens okot feltételez. Az evolúció útjai kifürkészhetetlenek – mondja ezért legtöbbször. El kell hinnünk, hogy az evolúció hipp-hopp képes többször is, különböző utakon létrehozni olyan elképesztően bonyolult szerveket, mint a szem, és ha nem is ismerjük még a folyamat géncentrikus (vagy valamilyen lamarcki) útvonalát, majd valamikor meg fogjuk ismerni. Ez egy metafizikai alapállásból fakadó hit, kevés empirikus alappal.

    Azt viszont tudjuk már most is, hogy intelligencia képes létrehozni komplex, funkcióspecifikus információt, és képes információ-vezérelt rendszereket építeni (még ha az emberi intelligencia olyan elképesztően szofisztikált tervezésre eddig nem is volt képes, mint amilyeneket az élővilágban találunk). És azt is tudjuk, hogy irányítatlan anyagi folyamatok ilyeneket viszont nem hoznak létre. Az evolúciós kísérletek és megfigyelések (E-coli, HIV, PfCRT, MEGA) is eddig ezt támasztották alá.

    A bibliai világkép Teremtő Istenről beszél, aki több lépcsőben hozta létre a kozmoszt és az élővilágot. (Itt egy példa arra, hogy a naturalizmussal ellentétben egy keresztény milyen előfeltevésekkel tudja például tanulmányozni a teremtett világot.) A modern tudomány atyái ebből a kiindulópontból közelítettek a valóság megértéséhez, és ennek a kiindulópontnak ma sincs kisebb létjogosultsága, mint mondjuk a Cavendish laboratóriumot világhírűvé tevő Maxwell idejében, akinek a hatása a mai napig meghatározza a Cambridge-i tudományos életet.

    A teista alapról végzett tudomány Isten cselekedeteit akarja kikutatni (ahogy a Cavendish Laboratory kapuja is hirdeti), ezért arra kíváncsi, hogy Isten hogyan teremtette a világot, legalábbis ami a jelenségek vizsgálatából megismerhető. Ha evolúció által, akkor azt akarja megismerni. Ha sokféle szinguláris teremtő aktus által, akkor azt. Nem zárja le ezt a kérdést, ahogy a naturalizmus teszi, nem is kémiai-fizikai törvények zárt rendszerét feltételezi, ezért a kételyeknek is helyt ad, amikor az információ szakadékait látja a múltban és az információ jelenlétével találkozik a jelenben. A naturalizmus nem következik a tudományból, ezért tudományos kiindulópontnak sem kell feltétlenül elfogadni, már csak azért sem, mert még az ateista Paul Davies szerint is az a modern tudomány egyik iróniája, hogy monoteista fiduciáris kereteken belül dolgozik (ezt Polányi is megerősíti).

  • Lima Rui says:

    Valójában azért teszem fel ezeket a költői vagy nem sokra vezető kérdéseket, mert Istennel mindent meg lehet magyarázni. Úgy vélem ezt csak úgy tudnám megfogni, ha felesleges vagy logikátlan struktúrákra világítok rá. A junk DNA pl ilyen, ezért is érvelsz amellett, hogy ilyen valójában nincs is. És abban igazad van, hogy ez nem fér meg a tervezettség mellett. De a junk DNA-n kívül (ami lehet hogy nem 80%, de a 8% se kicsi szám, és az se bizonyíték a junk DNA ellen, hogy valaki nagyhangúan kijelentette, hogy márpedig 80%, aztán belátta, hogy tévedett) más is van, ami hasonló, pl ezek a rendellenességek, amikre próbáltam rávilágítani. Persze ezekre is rásüthető végső érvként, hogy nem tudhatjuk, hogy egy nálunk nagyobb intelligencia mit miért tesz. Ami igaz is. Viszont ezzel el is vágod a vitát és nincs értelme a további beszélgetésnek.

  • Szabados Ádám says:

    A felesleges vagy logikátlan struktúrákra való hivatkozás kezdettől a darwinizmus érvkészletéhez tartozik. A tendencia azonban az, hogy ez az eszköztár egyre kisebb, miután az élővilág tudományos vizsgálata, a tudományos kíváncsiság újból és újból oda vezetett, hogy mégiscsak funkciót találtunk funkciótlannak, feleslegesnek hitt szervek kapcsán. A legutóbbi eset a junk DNS, a korábban hulladéknak hitt genomrészek ügye. (Ezzel kapcsolatban itt egy friss cikk, ami arról számol be, hogy újabb szög került az evolúciós ikon koporsójába.)

    Most viszont le kell lépnem a netről egy időre.

  • Szabados Ádám says:

    Ha esetleg a linket nem néznéd meg, itt van, amit a világhírű elméleti fizikus Paul Davies a tudomány monoteista alapjairól mond:

    „A tudós világnézete – a leginkább ateista tudósé is – lényegében monoteista. A tudósok hitcikkelyként fogadják el a hitet, hogy az univerzum értelmes módon rendezett. Az a helyzet, hogy nem lehet senki tudós anélkül, hogy ebben a két dologban hinne. Ha egy tudós nem gondolná, hogy van rendezettség a természetben, nem törné magát, hogy megismerje, hiszen nem lenne mit felfedezni. Ha nem hinné, hogy a rend értelmes, feladná a kutatást, hiszen a kutatásnak semmi értelme, ha az emberek nem juthatnak megértésre. De a tudósok hittel elfogadják, hogy a világegyetem rendezett, és hogy – részben legalábbis – megérthető az emberek számára; és ez az, ami az egész tudományos vállalkozás alapja. Ez azonban teológiai alapállás. Ha a történelmet vizsgáljuk, teljesen egyértelmű, hogy a tudomány ebből a teológiai világnézetből jön… nagyon-nagyon fontos, hogy történelmileg innen jön, és a tudósok hitbeli cselekedetként rendületlenül kitartottak emellett az alapállás mellett… A tudósok többnyire magától értetődőnek veszik ezt, de szerintem hallatlanul fontos, hogy szóvá tegyük.”

  • Lima Rui says:

    Köszönöm a beszélgetéseket. Nem látom értelmét folytatni, hisz elbeszélünk egymás mellett és valójában minden itt leírt karakter eggyel csökkenti az aznap az íródó cikkembe bekerülő karakterek számát. Ez egy szélmalomharc (a részemről, de a részedről is), hisz bármilyen intelligens és jól tájékozott vagy, szerintem nincs meg a kellő ismereted a biológia területén, és ami van, az is elsősorban egyoldalú forrásokból táplálkozik. Persze ez nem meglepő, tudtommal nem végeztél egyetemet a területen és nem is dolgoztál biológusként vagy kutatóorvosként. Nem tudlak meggyőzni, de nem is számítottam rá. De arra se számítottam, hogy ekkora falakba fogok ütközni. De talán nem is baj, hisz ha megroggyantom a hitedet (persze nem Istenben, csak a Tervezettségben vagy megcsillantom, hogy lehet mégis az evolúcióban valami) az se feltétlenül jó. Ráadásul mire megyek vele? Én legalábbis így értelmeztem ezt a filmet, amit a nyáron láttam, és illik is ide: http://www.imdb.com/title/tt0418455/
    Üdv!

  • Szabados Ádám says:

    Egyoldalúan nehéz lenne tájékozódnom olyan közegben, ahol a tiédhez hasonló gondolkodás a domináns, de csak azt tudom mondani, hogy gyere jobb érvekkel, mint azok a biológusok, genetikusok, biokémikusok, matematikusok, nyelvészek és tudományfilozófusok, akiknek az érvei engem meggyőztek.:) Az igazság érdekel, de jelenleg sem a naturalizmus, sem a neo-darwinizmus nem hat rám az igazság erejével. Mindenesetre én is köszönöm a beszélgetést. A linket majd megnézem.

  • jgabor says:

    Lima Rui,

    Végigkövetve a vitátokat azt kell hogy mondjam, hogy érzésem szerint ez a posztlúdium a részedről eléggé méltatlanra és fellengzősre sikeredett:

    „Ez egy szélmalomharc (a részemről, de a részedről is), hisz bármilyen intelligens és jól tájékozott vagy, szerintem nincs meg a kellő ismereted a biológia területén, és ami van, az is elsősorban egyoldalú forrásokból táplálkozik. Persze ez nem meglepő, tudtommal nem végeztél egyetemet a területen és nem is dolgoztál biológusként vagy kutatóorvosként. Nem tudlak meggyőzni, de nem is számítottam rá. De arra se számítottam, hogy ekkora falakba fogok ütközni. De talán nem is baj, hisz ha megroggyantom a hitedet (persze nem Istenben, csak a Tervezettségben vagy megcsillantom, hogy lehet mégis az evolúcióban valami) az se feltétlenül jó.”

    Ádám sohasem állította, hogy egyetemet végzett volna biológiából, vagy kutatóorvos lenne. Viszont idézett elég sok ilyen tudóst, akik közül sokan mellesleg nem feltétlenül Istenben hívő emberek. (Rólad sem derült ki számomra, hogy mit végeztél, milyen eredménnyel, stb.)

    Pont az előbb olvastam, hogy a Liszt Ferenc Nemzetközi Zongoraversenyen a zsűriben – világhírű zongoristák, zenészek közt – ott ült Mácsai Pál színész is. Senki nem kérte tőle számon a zeneakadémiai diplomát, egyenrangú partnernek tekintették, mert ért hozzá.

    Úgy beszélsz, mintha csak lovagiasságból nem gáncsoltad volna ki az érveiddel Ádámot, pedig igazából simán megtehetted volna.

    „De arra se számítottam, hogy ekkora falakba fogok ütközni.”

    Mire számítottál? Blitzkriegre?

  • Lima Rui says:

    Átrágom majd magamat ezeken az írásokon.
    Erre azért még kíváncsi lennék:
    “Az, hogy egy teremtett világban miért van rák, fontos teológiai kérdés, amire a teológiának van is válasza”
    Hisz ez nem fér be a jóságos és igazságos Isten-képbe. Ráadásul rák állatokban is kialakulhat, ami talán nehezíti a magyarázatot.

  • dzsaszper says:

    Kedves Lima Rui,

    ha jól értelek, ha egy apa elengedi a tékozló fiút az örökségével, akkor nem lehet jóságos, mert a fiú disznóvályú mellett köthet ki… Jól értelek?

  • Lima Rui says:

    Kedves dzsaszper,

    ez inkább az a helyzet, amikor a tékozló fiú öröksége valójában adósság és az apa mossa kezeit utána.

  • dzsaszper says:

    Feltéve, hogy az adósságot nem a fiú saját maga halmozta fel…

  • Lima Rui says:

    A hasonlatok csak kerülgetik a forró kását. Pontosan mire gondolsz?
    Ő lenne pl a tékozló fiú?:
    http://hvg.hu/elet/20160915_gyerekrak_go_gold_arany_szalag_kampany_brit_edesanya_level_iskolakezdes
    Esetleg kifejthetnéd, hogy mit gondolsz a kérdésemről vagy hogy miért rossz.
    “Az, hogy egy teremtett világban miért van rák, fontos teológiai kérdés, amire a teológiának van is válasza”
    Erre a válaszra lennék kíváncsi. A többit csak azért csaptam hozzá, hogy felesleges köröket ne fussunk, de ellentétes hatást értem el vele.

  • Szabados Ádám says:

    Kedves Lima Rui,

    a teológia válasza többek között abból indul ki, hogy a teremtett világot Isten hiábavalóság alá vetette (vö. Római levél 8. rész 18-25. versei), ezért az, amit Isten eredetileg jónak alkotott, sok tekintetben megromlott, szenvedő, sóvárgó világ lett. A romlandóságnak való alávetés oka az angyalvilág és az ember lázadása. A rák a teremtett világ romlandóságának egyik megnyilvánulása. Ez a teológiai magyarázat egyik kiindulópontja, de a kérdés messze vezet a cikk témájától, ezért azt kérem, hogy ne itt beszéljük meg.

  • dzsaszper says:

    Kedves Lima Rui,

    Ádám kérését tudomásul véve csak nagyon röviden válaszolok:
    A tékozló fiú szerintem az emberiség, annzival megspékelve, hogy nem csak magunkat, hanem az egész földi élkővilágot a disznóvályúkhoz juttattuk…

  • Szabados Ádám says:

    Az elmúlt napokban a blogmotor automatikusan megakasztott és a szemetesbe tett pár hozzászólást, amit csak most vettem észre és ezért csak most tudtam átengedni őket. Minden érintettől elnézést kérek!

  • Lima Rui says:

    jgabor,
    ” (Rólad sem derült ki számomra, hogy mit végeztél, milyen eredménnyel, stb.)”
    ELTE-n végeztem molekuláris biológus, mikrobiológusként. Most a doktorimat csinálom. Van 2 társszerzős cikkem: http://www.ncbi.nlm.nih.gov/pubmed/?term=lima+farkas+kondorosi+kereszt . Most írom a saját cikkemet és a disszertációmat és közben még pótolom a hiányzó eredményeket, remélem karácsonyig sikerül. Augusztus végén a munkámról tartottam előadást egy nemzetközi konferencián (ez és a következő kép): https://photos.google.com/share/AF1QipOelaUPmQAo_vzZbXuRrNx87OxYpq4TO9gXas_6TIBwTsTARzOGTxrGYHj7b7kkdg/photo/AF1QipNRrBQGtu7D4L2zWv5kt33lmF551C1zsBo05nhh?key=OXdlMlQ1WUVMRHBNQjFDYTUxdE5jMV9LMEptbXd3
    “Mácsai Pál színész is. Senki nem kérte tőle számon a zeneakadémiai diplomát, egyenrangú partnernek tekintették, mert ért hozzá.”
    Nekem is van biológia tanár, élelmiszer mérnők, sőt torna tanár végzettségű kutató kollégám is és egyenrangú partnernek kezeljük őket. Mert értenek hozzá.
    “Viszont idézett elég sok ilyen tudóst, akik közül sokan mellesleg nem feltétlenül Istenben hívő emberek.” Egy általa linkelt tanulmányból kiderült, hogy ő a releváns kutatók 5,6%-ától idéz (ők az evolúció-szkeptikusok). Én a nem elenyésző 94,4% álláspontját képviselem. Valamint Ádám Stephen Kingtől is idézett a témában, így nem vagyok róla meggyőződve, hogy megfelelően súlyozza, hogy ki mennyire releváns.
    A türelmem azért fogyott el, mert elég hosszasan írtam, konkrét problémákat vetettem fel és gyakran nem kaptam választ. Ádám 2 tanulmányt is linkelt itt, mindkettőt elolvastam és véleményem szerint az első cikk konkrétan rossz, el is magyaráztam, hogy miért, a másikat meg Ádám értelmezi félre. Egyik fejtegetésem se ért el különösebb hatást, mélyebb megértést, ezért úgy éreztem mintha falba ütköztem volna. Persze az is lehet, hogy én nem magyaráztam elég jól, de bármi is az oka feleslegesnek éreztem továbbra is hosszan elemezgetni a problémákat. Ádám jól tájékozott a témában, de átfogó, általános ismeretei szerintem hiányoznak. Ami nem baj, csak akkor ha épp erről vezet blogot, folytat vitát. (Persze a saját blogján azt csinál amit akar.) Például: az ExAC tanulmány kapcsán hiányolja a pozitív mutációkat, így bizonyítva látja azt, hogy azok nemigen jelenhetnek meg akkora mértékben, hogy új fajok evolválódjanak. Csakhogy ez a tanulmány a genom 0,16%-át (igaz, a fehérjekódoló gének 16%-át) vizsgálja, ráadásul olyan génekről van szó, melyek természetükből adódóan nem tolerálják a mutációkat. Az ilyen gének rendkívül lassan evolválódnak, hisz a legkisebb mutáció is végzetes lehet, ami történhet ugyan “pozitív” irányba, de mivel az ember diploid szervezet, ezért a heterozigótákban felléphet inkompatibilitás, hiába előnyösebb az új mutáció, a másik allélel nem kompatibilis és a fehérje nem fog működni. A tanulmány nem beszél pozitív mutációkról, mert ilyet embernél hogy tudnának screenelni? Hogy állapítanák meg, hogy az indiánok X génjének allélje jobb, mint a kaukázusiaké? Elárulom: sehogy. Ilyet nem feltétlenül vizsgálnak etikai okok miatt, nem is érdemes, hacsaknem betegséget hordoz a gén és technikailag se könnyű, nemhogy 1 génnél eltarthat évekig, de itt 3230-ról van szó. Ádám érvként hozta fel a cikket egy olyan témában, melyről a cikk nem is beszél, ami akár nem is lenne baj, ha nem értelmezte volna félre. De nem reagált érdemben a fejtegetéseimre. Mióta kikerültem az egyetemről megszázszorozódott a tudásom, illetve sokkal értékesebb lett, mert rengeteg mindent csak akkor látsz át, ha szerzel róla gyakorlati tapasztalatot. Ez Ádámnak nincs meg. Nem is lehet. Mácsai Pálnak lehet jó füle, érthet a zenéhez úgy is, ha nem tud zongorázni. A biológia más.

  • Szabados Ádám says:

    Kedves Lima Rui,

    engedd meg, hogy megvédjem egy kicsit magam. Soha nem állítottam, hogy biológus volnék (sőt), és egy pillanatig nem vitatom, hogy a részleteket illetően lényegesen nagyobb tudásod van ezen a területen, mint nekem. Az érveid viszont nem jobbak, mint azoké a biológusoké (biokémikusoké, matematikusoké, tudományfilozófusoké, paleontológusoké), akiknek az érveire szintén odafigyelek, és akik közül többnek viszont a tiédnél (valószínűleg) nagyobb és elismertebb (és gyakorlottabb) a tudása.

    Mikor St. Louisban éltem, mikrobiológus professzor (PhD, egyetemi tanári állás, kutatói munka) barátommal sokat beszélgettünk. Ő például ezekben a dolgokban más állásponton van, mint te, és elmondása szerint sokkal-sokkal többen vannak, akik úgy gondolkodnak, mint ő, mint ahányan – állásaikat és tudományos programjaik finanszírozását féltve – ezt nyíltan felvállalják. Senki nem vitatja, hogy a domináns paradigma ma a neo-darwinista paradigma. Azt vitatják sokan (igen, egyelőre a kisebbség, de nem jelentéktelen kisebbség), hogy a tények a neo-darwinista paradigmát támogatják. Én pedig meggyőzőnek találom az érveiket.

    Egyébként én magam is kutatómunkát végzek (jelenleg éppen Cambridge-i könyvtárakban), noha humán területen, ami valóban sok tekintetben eltér a természettudományoktól. Humán területen kutatni egy dologban azonban előnyt jelent. Mi, humán területen mozogva, jobban tudatában vagyunk azoknak a világnézeti, metafizikai, tudományfilozófiai előfeltevéseknek, amelyek a módszertanokat és az eredményeket nagyban befolyásolják, időnként eleve determinálják. Amikor az élet eredetével kapcsolatos kérdéseket vizsgálom, engem ezek a kérdések mindig foglalkoztattak, sokat olvastam és olvasok róluk (eldöntheted, mennyire egyoldalúan vagy sem), és mivel ki vagyok élezve rájuk, feltűnő számomra, amikor a tudomány művelői naivan állnak saját előfeltevésekhez. Nálad is több ponton az előfeltevéseidre való reflexió hiányát érzékeltem.

    Ami meg konkrétan a két belinkelt cikket illeti: a Sanford tanulmányával kapcsolatos ellenérveid nem győztek meg, többször is válaszoltam az érveidre. A másik cikkel kapcsolatban rosszul adod vissza az ellenérvemet, amikor ezt írod: „az ExAC tanulmány kapcsán hiányolja a pozitív mutációkat, így bizonyítva látja azt, hogy azok nemigen jelenhetnek meg akkora mértékben, hogy új fajok evolválódjanak”. Én nem ezt mondtam. Én azt mondtam, hogy míg az ExAC cikk említ neutrális és lethális mutációkat, nem említ előnyös mutációt, noha az egész kutatásnak orvostudományi célja van. Ez persze lényegében nem sokat ad hozzá Sanford matematikai érvéhez (vagy vesz el belőle), inkább csak alátámasztja kísérleti úton is azt a máshonnan is ismert tényt, hogy előnyös mutációk nem gyakran történnek, ezért a várakozási idő első problémája már önmagában is komoly probléma. Azt viszont nem állítottam (sőt, az ellenkezőjét állítottam), hogy ne lehetne előnyös mutáció. Hogy az ExAC csak a genom 0,16%-át vizsgálta? Tudsz olyan kutatásról, ami legalább ekkora genomrészt átnézve jobb eredményre jutott?

    Nem muszáj folytatnunk a vitát, mert neked is dolgoznod kell a doktoridon, nekem is, és már így is mindketten elég időt öltünk ebbe az eszmecserébe. Én most az ἐπίσημοι ἐν τοῖς ἀποστόλοις szintagma pluralis dativusának jelentésárnyalatait kutatom, itt tornyosul mellettem legalább harminc könyv, lexikon és folyóirat, kérik a figyelmemet. Úgyhogy átérzem a te helyzetedet is, és sok erőt és okosságot kívánok a kutatásaidhoz!:)

    Üdv:
    Ádám

  • Lima Rui says:

    Köszönöm és viszont kívánom. Elnézést az arrogáns viselkedésért.
    Üdv
    Rui

  • Gergely Erzsébet says:

    Értékes számomra, hogy olvashatom e föntebbi, Ádám és Rui közötti
    “párbeszédet”. Bár a téma messze meghaladja tudásomat, ennek elle –
    nére mégis szépséges. Szívemben megújul a hála az internetért. Nél –
    küle miként lehetne részem ilyen, és hasonló élményekben?!

  • dzsaszper says:

    Kedves Lima Rui,

    amit igazából kicsit furcsálltam — főleg azzal kapcsolatban, amikor azt írtad, falba ütköztél — hogy az érvelésed kimerült abban, hogy Ádám érveit megpróbáltad több vagy kevesebb sikerrel cáfolni.

    Nem láttam tőled saját érvet, például amellett, hogy az extrapoláció miért végrehajtható és miért esik a tudomány hatáskörén belülre, és miért mondana bármi többet annál, hogy akár úgy is történhetett…

    Mintha te magad húztál volna falat magad köré, ameddig hajlandó vagy érvelni — szinte tisztán reaktív érveléssel. Így elég nehéz meggyőzni a vitapartnert bármi többről, minthogy esetleg kicsit finomítania kell még az érvelését, vagy vannak még hiányzó láncszemek (Darwin után szabadon 🙂 ). Szerintem tehát nem volt min meglepődnöd…

  • Gergely Erzsébet says:

    “Értékes számomra, hogy olvashatom e föntebbi, Ádám és Rui közötti
    “párbeszédet”. …………………………………………..”

    Szükséges pontosítanom:

    Értékes számomra, hogy olvashatom e föntebbi, Ádám, Rui és a többi
    kommentelő közötti “párbeszédet”. …………………………..

  • Lima Rui says:

    Kedves dzsaszper!
    Mivel egy cikkre reagáltam, szerintem érthető a reaktív érvelésem. De, hogy ne intézzem el ennyivel. Egy: Én közel se ástam bele magamat annyira a témába, mint Ádám, nem olvastam se a laikus nagyközönséget célzó írásokat, de még a tudományos vizsgálatokat, eredményeket se követem, hisz nem ez a szakterületem és ha már cikkeket olvasok, akkor illene azon több százból választanom, amire szükségem van a kutatásaimhoz. Kettő: A Teremtéssel minden megmagyarázható, így bármi érvet hozok fel, az támadható. Viszont úgy gondolom, hogy egy felsőbbrendű intelligencia nem teremt felesleges struktúrákat, illetve a teremtett funkciók és azok manifesztációja követ egy elemi logikát. Egyszóval a „miért”-et keresem, amit szintén le lehet mosni azáltal, hogy „nem tudhatjuk, hogy egy felsőbbrendű intelligencia mit miért tesz”, de talán mégis szöget üt a fejünkbe, hogy „jó, jó, de azért tényleg furcsa, hogy ez pont így van”. De hoztam fel saját érveket is, bár más cikkeihez is kommenteltem. Pl.: az ortológ olyan gén, mely legalább 2 fajban megtalálható és ugyanazt a funkciót látja el. A génjeink 99%-a megegyezik a csimpánzéval, 60% a muslicáéval, ezek mind ortológok. De habár a funkciójuk ugyanaz, szekvenciálisan különböznek kisebb-nagyobb mértékben, a csimpánznál jóval kevésbé, mint az egérben, míg a muslica még messzebb áll tőlünk. De ez nem igaz minden génre: a riboszómális alegységek génjei sokkal kevésbé változatosak, a legtöbb eukariótában csupán pár nukleotid az eltérés, de még a prokariótáké is hasonló (archaeáké sokkal inkább, mint a baktériumoké). Így felállíthatóak molekuláris családfák és ez mindig szépen egybevág, csak néha zavarhat be a horizontális géntranszfer (HGT), de általában annak is vannak szekvenciális nyomai. És ugyanígy a HGT események is rögzítettek a vonalakban. Valójában a közös leszármazás nem vitatható. A közös leszármazásra adhat az evolúció egy választ, hogyan fejlődtek a fajok egymásból, hogyan lesz 1-1 HGT esemény vagy az ortológok szekvenciája, gének megléte/hiánya jellemző 1-1 vonalra. Ugyanez a Teremtéssel is megmagyarázható, hisz azzal minden megmagyarázható. Csak felmerül bennem a kérdés, hogyha ugyanaz a gén funkciója, akkor miért térnek el szekvenciálisan az egyes fajokban? És sokszor bizonyítottan funkcionálisan is, hisz különböző fajok ortológjai komplementálják, helyettesítik egymást, pl a glifozát rezisztens szója egy jól ismert példa, de ez általánosan bevett gyakorlat a laborokban (remélem én is tudom rizs génnel helyettesíteni a lucerna ortológot, aminek a működését elcsendesítettem. Sőt, ha a muslica génnel is sikerülne…). Persze, magyarázható azzal, hogy a Teremtő alapul vett már előzőleg megteremtett fajokat, amikor „kikotyvasztotta azokat a laborjában” vagy kipattant a „fejéből”. De akkor miért van az, és közeli rokon fajoknál (bár az evolúció-tagadóinak ez nem értelmezhető, hacsaknem az előző mondatomat vesszük alapul) vagy erősen konzervált géneknél (riboszómális alegységek) ez általános, hogy van nukleotid eltérés, de nincs aminosavbeli változás (samesense mutáció). Minek belerakni az eltérést, ha annak nincs funkciója? Ha bizonyított, hogy a 2 gén tudja egymást helyettesíteni, akkor miért van más-más változat? Ádám szerint nincs junk DNS, mindennek van szerepe, ami logikus is, ha valamit tudatosan terveznek, abba nem raknak sallangokat. Tehát akkor ezeknek az eltéréseknek is kéne szerepe lenniük és mondhatnánk, hogy akár lehet is, hisz nem tudhatunk mindent, de mégis funkcionálisan helyettesíthetik egymást, még hatalmas különbségeknél is. Akkor mire fel az egész? Az evolúció erre szép választ ad: a felhalmozódott véletlenszerű mutációk, melyeknek a különböző fejlődési vonalakban más-más történetük van. Én úgy vélem, hogy a Teremtő esetén a válasz az, hogy „nem tudhatjuk” vagy „Isten útjai kifürkészhetetlenek”. Kíváncsi voltam, hogy kapok e esetleg valami kielégítőbb választ, vagy elgondolkodásra késztetem legalább Ádámot vagy a többi posztolót. Amennyiben ezt a 2 idézőjeles választ kapom, akkor nem látom értelmét a beszélgetésnek, hisz így ez mindenre adható válasz, míg nekem minden kérdésre tudományos feleletet kell adnom, ami gyakran kivitelezhetetlen, hisz az evolúció, ha létezik, közel 4 milliárd éven át zajlott, milliárdszor milliárd élőlényben, melyeknek elenyésző részéről van nyomunk vagy tudomásunk.
    Hasonlóan a „miért”-re kerestem már választ a mitokondrium/kloroplasztisz jellegzetességeire (intronok, bakteriális DNS ill egyáltalán minek bele DNS, bakt. membrán, bakt. riboszómák ill egyáltalán a létük, miért eltérő ezen sejtszervecskék génjeinek száma az egyes fajokban, ha mégis mindegyikben ugyanúgy működik és ez miért követi ez a „rokonsági” kapcsolatokat?), a HGT, mint ősi események lenyomata (minek egyáltalán, gyakran géneket tesznek működésképtelenné, vagy pl a méhlepény syntitiumot egy retrovirális HGT okozza, pedig az isomsejtjeink syntituma enélkül is létre tud jönni, minden méhlepényes emlős ugyanott hordozza ezt a beépült retrovírust), az emberi genom 44%-a transzpozon, amik csak a bajt csinálnák, ezért csupán a 0,05%-uk aktív (ha aktiválod a többit egérembriókban, akár csak egyet, akkor ez pikk-pakk elpusztul), Ádám kedvence a junk DNS (attól még, hogy Collins elhamarkodott kijelentést tett, attól még létezik: hiába lehet szerepe az intronoknak, akkor is rengeteg szekvenciális szemét gyűlik fel bennük a gyenge szelekció miatt).
    Szerintem ezek elég jó érvek. Igaz, mind egy kaptafára van és mind elintézhető egy válasszal. Ha a „nem tudom”-ot válasznak tekintjük. Persze az embernek nincs mindenre válasza, nekem se. Ezekre a kérdésekre viszont van válasz a „nem tudom”-on kívül is, ami ugyan nem jelenti azt, hogy a helyes válasz, de a tudomány válaszokat keres. Természetes, sőt helyes, hogy megpróbáljátok cáfolni azt, amit tévesnek véltek, tehát a ti esetetekben az evolúciót, de ha ezt nem konstruktívan teszitek, akkor kár az erőfeszítés és Newton fejére az angyalok dobálják az almát (ez még ugyanúgy nincs cáfolva).

  • Szabados Ádám says:

    Lima Rui,

    látom, nem hagy nyugodni a dolog.:) Ha mindazt, amit most elmondtál, átfordítod a Windows 10 op rendszer evolúciójára (ami egy lényegesen egyszerűbb rendszer, mint a legegyszerűbb életformáé), azonnal látod, mi a problémánk a paradigmáddal, és azt is, miért nem tudománytalan feladni az anyagi okok kutatását ott, ahol intelligens tervező léte tud csak magyarázatot adni az információ-vezérelt teleológiai rendszer létrejöttére. (A Windows op rendszer fejlesztésének története hasonló jelenségeket hagyott maga mögött, mint az élet története, mégsem tudod megmagyarázni az intelligens okok figyelmen kívül hagyásával. Az anyagi folyamatok lyukait az intelligencia tölti ki, akkor is, ha annak működési folyamatait egy ilyen tervezésben a legbátrabb és legelvakultabb materialisták sem kísérlik meg feltérképezni.)

    Az életformák közötti hasonlóságot senki nem vitatja. Azt vitatjuk, hogy az életformák egymásból, fokozatosan alakultak ki, irányítatlan anyagi folyamatok révén. Ez tűnik sokunk számára sci-finek, matematikailag lehetetlennek, másszóval tudománytalannak. És ezt nem csak néhány bugyuta kreacionista hívő mondja, hanem számos elismert biológus, biokémikus, matematikus is, köztük Nobel-díjasok, mint Ernst Chain és Richard Smalley, valamint ateisták és agnosztikusok is, mint Fred Hoyle, David Berlinski, Thomas Nagel, Jerry Fodor és Piattelli-Palmarini. Konkrétan a neo-darwinista mechanizmussal kapcsolatban pedig Dunát lehetne rekeszteni a szkeptikus tudósokkal.

    Említetted, hogy Stephen Kingtől is idéztem, ezért nem biztos, hogy jól súlyozok a releváns kritikák között. Igazad lenne, ha Kingtől csak úgy idéznék, de világossá tettem, hogy vele és másokkal (pl. Vladimir Nabokov, Tom Wolfe, Dean Koontz) kapcsolatban a közvélekedés és a humán oldal szkepticizmusát mutatom meg, és a cikk végén hangsúlyoztam, hogy a kérdésnek vissza kell kerülnie a tudomány területére. A humán oldal kritikája azonban fontos visszajelzés is lehet az emberi intuíciók oldaláról. Parmenidész bebizonyította annak idején, hogy nincs mozgás, a józan intuíció azonban fogást keresett az érven, mert ösztönösen tudta, hogy ez nem igaz. Valahogy így vagyunk sokan humán oldalon: ösztönösen tudjuk, hogy a véletlen és a szükségszerűség nem épít felhőkarcolókat, szuperszonikus repülőgépeket és operációs rendszereket, intelligencia viszont igen. Azt érezzük, hogy valahol valami miatt félrement a tudományos kutatás, ha mégis ebben az irányban akar áttörést elérni. Úgyhogy keressük az érvekben a hibát. És azt látjuk, hogy nagyon könnyű megtalálni őket, mert szinte mindenütt lyukas a sajt.

    Egyébként figyeld meg, hogy Istent rendszeresen te hoztad be a képbe, nem én. Én végig amellett érveltem, hogy irányítatlan anyagi folyamat nem képes létrehozni azokat a teleológiai rendszereket és azt az információt, ami az élővilágban megfigyelhető, és matematikailag nem lehetséges az a folyamat, amit a neo-darwinizmus az ember evolúciójáról elgondolt. Nem korrekt, hogy állandóan azt hangoztatod, hogy Istennel mindent meg lehet magyarázni. Egyelőre te próbálod az evolúcióval megmagyarázni a jelenségeket, miközben ezer esetből kilenszázkilencvenkilencszer csak a hit van ott, hogy az evolúció valahogy megcsinálta, mert valahogy meg kellett csinálnia (mert különben marad a… marad a… jaj, marad a Teremtő hipotézise, ami biztosan nem lehet… ugye, nem lehet…)

  • Lima Rui says:

    Annyiban hagytam volna, de jgabor és dzsaszper nem engedte és így legalább Gergely Erzsèbetnek is van mit olvasnia 🙂 Isten helyett írhattam volna Teremtő Intelligenciát is, de az hosszabb és te keresztény vagy. Mivel amellett érvelsz, hogy ilyen összetett rendszereket és funkcionális információt csak intelligencia hozhat létr, ezért hívhatjuk Istennek is, hisz ha nem his Isten de ekvivalens vele. . De megint átsiklottál a problémáim felett.

  • jgabor says:

    Lima Rui,

    Én csak jeleztem feléd, hogy bántotta a fülemet, ahogyan kurtán-furcsán kiszálltál a vitából. Köszönöm, hogy reagáltál rá, én rendben vagyok veled. További sok sikert kívánok neked a kutatásaidban, munkádban!

  • dzsaszper says:

    Kedves Lima Rui,

    köszönöm a válaszodat.
    Egyes érveid kapcsán hasonló ellenvetéseim vannak, mint a te ellenvetéseid az ID vagy akár Ádám érvei irányába 🙂

    Kettő: A Teremtéssel minden megmagyarázható, így bármi érvet hozok fel, az támadható.
    Csak ezen az alapon inkább vallási jellegű vita lenne támadni. A magam részéről keresztyénként is tudományos jellegű vitát szeretnék folytatni — ami természetesen nem jelenti a neodarwinista álláspont elfogadását.

    Viszont úgy gondolom, hogy egy felsőbbrendű intelligencia nem teremt felesleges struktúrákat, illetve a teremtett funkciók és azok manifesztációja követ egy elemi logikát.
    Nos, ehhez már két érdemi észrevételem volna.
    Az egyik az az, hogy Te hasonlóan nehezen állapítod meg, mi felesleges, és mi mögött van logika és mi mögött nincs, ahogy a Te állításod szerint nehéz megállapítani egy mutációról, hogy előnyös-e. Attól hogy te nem látod a logikát és te feleslegesnek látsz dolgokat, vagy akár a témára specializált néhány legnagyobb koponya biológus van így vele, attól még lehet, hogy van ott logika és a dolog mégsem felesleges.
    A másik észrevétel: felteszem, hogy az emberi programozót az általa írt programokhoz képest tekinthetjük felsőbbrendű intelligenciának. Valahogy mégis csak tele van felesleges körökkel egy csomó szoftver. Egyszerűen nem a legnemesebb legelegánsabbb kód a fő cél, hanem olykor egyéb szempontok, például a meglévő kód újrahasznosítása stb.

    Valójában a közös leszármazás nem vitatható.
    Mit értünk közös leszármazás alatt? Nézd meg az autó modellek fejlődését, akárcsak néhány autótervező munkásságát… Valójában az nem vitatható, hogy vagy a leszármazás, vagy a tervező közös.

    Én úgy vélem, hogy a Teremtő esetén a válasz az, hogy „nem tudhatjuk” vagy „Isten útjai kifürkészhetetlenek”. Kíváncsi voltam, hogy kapok e esetleg valami kielégítőbb választ,
    Nem gondolom, hogy a Teremtő esetén minden kérdésünkre ez lenne a válasz. Sokan sokféle tudományágban mertek kutakodni keresztényként, és jó kérdés, hogy a tudomány hol tartana ma nélkülük…
    Ugyanakkor Teremtő nélkül is belefuthatsz a “nem tudhatjuk” válaszba olykor, ld. pl. a logikát és Gödel nem-teljességi tételét. Egyre jobb közelítést persze idővel tudunk, de egyrészt, van egy halom évtizedek óta megválaszolatlan rejtély, másrészt, ha nem vagyumk elég alázatos tudósok és azt gondoljuk, hogy mindent jól tudunk, akkor könnyen belefuthatunk olyan pofonokba, mint mondjuk a naiv halmazelmélet bukása volt, vagy a radioaktivitás kapcsán a tömegmegmaradás meghaladása…
    Ezeken a példákon keresztül azt próbálom érzékeltetni, hogy szerintem messze kisebb a különbség a Teremtőt elfogadó és elutasító tudósok hozzáállása között, mint gondolnád. Nagyon nem értem, miért véled úgy, hogy ezek lennének a válaszok?

    Amúgy volt egy válaszom a hasonló topikban, amire nem reagáltál, amivel azt gyanítom, lényeges kérdéskört kapirgászok, bár a tudományterület az elmúlt évtizedek után is gyerekcipőben járónak mondható: a DNS mint szemantikával rendelkező nyelv, aminek minden egyes sejtben (és prokariótában) ott a fordítórogram — még az is lehet, hogy egy adott nyelvjárásra.
    A genom lingvisztikai elemzésétől a magam részéről sokat várok, de egyelőre kb. az ABC-vel vagyunk tisztában.

    Igaz, mind egy kaptafára van és mind elintézhető egy válasszal. Ha a „nem tudom”-ot válasznak tekintjük. Persze az embernek nincs mindenre válasza, nekem se. Ezekre a kérdésekre viszont van válasz a „nem tudom”-on kívül is, ami ugyan nem jelenti azt, hogy a helyes válasz, de a tudomány válaszokat keres.
    Örülök, hogy utaltál arra, hogy “nem jelenti azt, hogy helyes a válasz”. Az ID-t valló tudósok, sőt a keresztény tudósok ugyanúgy tudományos válaszokat keresnek…

    de ha ezt nem konstruktívan teszitek, akkor kár az erőfeszítés és Newton fejére az angyalok dobálják az almát (ez még ugyanúgy nincs cáfolva).
    ahogy Newton példájának is örülök… Persze egyes teológiai nézeteivel nem értek egyet, de egyrészt köztudott, hogy a Bibliát is tanulmányozta, az alábbi idézet tőle pedig elgondolkodtató: “Gravity explains the motions of the planets, but it cannot explain who set the planets in motion. God governs all things and knows all that is or can be done”. Érdekes módon ez a gondolkodás Newtont sem késztette arra, hogy almát dobáló angyalokra gyanakodjon 🙂

    Én nem látom problémásnak azt, hogy a tudósok akármilyen vallásúak legyenek. Addig, amíg tudománytt művelnek a tudomány eszköztárával a tudomány hatáskörén belül. Azt tartom problémásnak, amikor egyrészt a hatáskör határait nem tartja valaki tiszteletben, másrészt amikor világnézeti alapon kimondatlan feltételezésekre épít valaki. Az eredetkutatás amúgy egy külön tudományterületnek tekintendő, szerintem sokkal több köze van az igazságügyi szakértéshez mint a klasszikus természettudományhoz. Egész más játékszabályok és itt-ott jelentősen más eszköztár szükségeltetik, hogy ne csússzunk nagyon félre. Ahogy gész más az, amikor egy fizikus a megtett utat, időt, sebességet, gyorsulást vizsgálja reprodukálható kisérletekkel, és egész más az, amikor egy igazságügyi szakértő egy konkrét mondjuk közlekeési baleset lényeges eseményeit próbálja rekonstruálni — remélem, érted mire gondolok.

  • Szabados Ádám says:

    Lima Rui,

    lehet, hogy nem sikerült, de éppen a problémáidra akartam válaszolni. Csak a részletek (a fák) helyett oda tolva a hangsúlyt, ahol szerintem az igazi kérdések vannak (az erdő). Te rámutattál genetikai hasonlóságokra, amelyeket az egyik életformából a másikba való evolúciós átmenettel magyarázol. (És most te is, én is gondoljunk azokra a részletekre – ortológok, riboszomális alegységek, samesense mutációk stb. -, amelyekkel ezt alátámasztottad, hogy ne érezd, elsiklok a problémáid felett.) Én nem kérdőjelezem meg a hasonlóságok tényét (bár a homológia számos korábbi példája éppen a genetikai eltéréseken bukott meg, és zavarba ejtő módon számos hasonló genotípus nagyon eltérő fenotípust eredményez), csak azt kérdőjelezem meg, hogy ezek a hasonlóságok az egymásból való átmenet bizonyítékai volnának. Erre hoztam példának a Windows op rendszer szoftverét, amelynek történetében egészen hasonló jelenségekkel találkozunk (homológ kódok, hibák makacs ismétlődése, apró javítások általi fokozatos fejlődés stb.), mégis tudjuk, hogy nem sztochasztikus evolúciós folyamatról van szó, hanem intelligens fejlesztésről.

    Ez eddig tudomány. Tudományos alapon juthatunk el arra a következtetésre, vera causa után kutatva, uniformista, abduktív módszertannal (vagyis Lyell és Darwin módszertanával), hogy az élet bonyolult kódokkal ellátott, hierarchikusan tárolt információ által vezérelt, teleológiai rendszereit irányítatlan természeti folyamatok nem tudják létrehozni (beleértve a természetes szelekciót, amely nem hoz létre innovációkat, csak szelektálja azokat), intelligencia viszont igen. Én ezt állítom, és azt, hogy ez pusztán tudományos alapon is megáll. Hogy miért, arra az intelligens okok detektálásának módja adja a magyarázatot. Hogy ismert példát hozzak, a Húsvét-sziget szobrairól azt feltételezzük, hogy azokat intelligencia hozta létre. Nem azért tudjuk ezt, mert bármit is tudnánk a létrehozó intelligenciáról, hanem azért, mert bizonyos jelenségek esetében erre következtetünk. (A szobroknál a komplexitás és az ismert minta – vagyis a CSI – együttes jelenléte a jelenségnek az a természete, ami intelligens okra mutat.) Ugyanígy következtethetünk intelligens okra a természet teleológiai rendszereit látva. (És még egyszer: nem csak „idétlen kreacionisták” teszik ezt, hanem Nobel-díjas tudósok is.) A Húsvét-sziget szobrai kapcsán megelégszünk a magyarázattal: intelligens lények (feltehetően emberek) találták ki a mintát és faragták azokat ki. Nem ismerjük az ötlet létrejöttének folyamatát, de ez nem akadály abban, hogy magyarázatként elfogadjuk. És ez egy hihetetlenül egyszerű alkotás az élet rendszereihez képest.

    Ekkor jön viszont a képbe a Teremtő kérdése, amire újból és újból visszatérsz. Ha Teremtő hozta létre a sejteket és az élet rendszereit, miért olyat alkotott, amiben ennyi hiba van, ráadásul makacsul ismétlődő hibák, amelyek mintha egyik élőlényből örökítődtek volna át a másikba? Ha jól értem, két problémát is megfogalmazol. Egyrészt azt, hogy a hasonlóságok ténylegesen örökítődésre utalnak (tehát közös leszármazásra), a másik az, hogy ha ez nem így volna, akkor a Teremtő ügyetlenül barkácsolt volna, ami méltatlan a keresztények (vagy akárkik) Istenéhez. Az örökítéssel kapcsolatos probléma szerintem sokkal nagyobb probléma a darwinizmus számára, mint amit általában elismernek a darwinizmus hívei, mert a genetikai hasonlóságok gyakran egyáltalán nem egyeznek a morfológiai hasonlóságokkal, amikre a darwini evolúciós törzsfa épült – de nem akarom megkerülni a kérdésedet. Valóban azt feltételezem, hogy a pszeudogének többsége funkcionális, de azt nem állítottam soha, hogy minden gén funkcionális lesz. Valószínűbbnek tartom, hogy funkciót fognak felfedezni jelenleg funkciótlannak és logikátlannak tartott gének esetében, mint azt, hogy valóban funkciótlanok és logikátlanok (az ENCODE Project óta szerintem minden józan tudós ezt teszi, F. Collins nyilatkozata becsületes és bölcs tudós nyilatkozata, nem is lehetett könnyű számára ez a beismerés), de azt is el tudom fogadni, hogy vannak ténylegesen hibás gének, amelyek nagyon hasonlóak – és hasonlóan hibásak -, mint más fajok genomjában lévő gének. (A csimpánzok és emberek közötti hasonlóság kérdéseiről belinkeltem fent egy halom cikket, most is azokat ajánlom elolvasásra.)

    Viszont a hibák esetében nem ugrom rögtön arra a konklúzióra, hogy azok egyik fajból a másikba örökített hibák, akkor sem, ha pillanatnyilag nem tudnék magyarázatot adni minden egyes konkrét példára, amit a szakirodalom jelenleg számon tart, és azt kell esetleg feltételeznem, hogy azok külön-külön, egymástól függetlenül alakultak ki a különböző fajokban. A darwinizmus ennél sokkal nehezebb utat jár, amikor a konvergens evolúció csodálatos magyarázatát adja nem hasonló gén-romlások, hanem egész rendszerek (pl. a szem) egymástól független megépülése kapcsán. Számomra ezerszer (nem, inkább összehasonlíthatatlanul, mérhetetlenül) valószínűtlenebb a darwinista konvergens evolúció számtalan feltételezett példája, mint az, hogy ugyanaz a romlás esetleg többször menjen végbe különböző fajokhoz tartozó génekben.

    A teológiai kérdésedet hagytam a végére: miért barkácsolna Isten? A válasz (a teológiai válasz) az, hogy nem barkácsolt, de nem is egy lépésben teremtette a világot, hanem több lépésben. Először a fényt, aztán a szárazföldet, aztán a tengeri élőlényeket, aztán a madarakat és a szárazföldi élőlényeket, majd a végén az embert. Érdekes módon ez a több ezer éves dokumentum éppen azt a sorrendet írja le, ami megvalósult, ahogy erre Arno Penzias Nobel-díjas fizikus is rámutatott, pedig abban az időben szinte semmit sem tudtak a paleontológiai mintázatról. A teológiai magyarázat azt is hangsúlyozza, hogy a mostani világ nem ugyanolyan, amilyennek Isten (fokozatosan) megteremtette, mert romlandóságnak vetette alá az angyalok és az ember lázadása miatt. Ez a teológiai magyarázata annak, hogy az élővilágban gyakran nem a harmónia jeleit látjuk. Ezzel együtt még mindig lenyűgöző a világ, lenyűgöző, ahogy a DNS másolódik, ahogy elképesztően kifinomult hibajavító mechanizmusok (!) biztosítják, hogy az esetek túlnyomó többségében hiba nélkül történik a másolás, hogy kék az ég, zöld a fű, virágoznak a virágok, pókok szövik gyönyörű hálóikat, millió és millió madár énekekkel hívja a párját, stb. stb. Erre mondtam neked, hogy olyan számomra, amikor az intelligens tervezést a hibák miatt megkérdőjelezed, mint mikor egyetlen hibásan nyomtatott oldal miatt megkérdőjelezed mind az író, mind a szoftverfejlesztő, mind a nyomtató tervezőjének intelligenciáját. A Tervező léte számomra nem kérdés. Inkább az a kérdés, hogy hogyan viszonyuljunk hozzá.

  • Lima Rui says:

    Ezek a szobrok humanoidok egy humanoidok (általunk) lakott bolygón, melynek arcvonásait igen nehezen faraghatta ilyen pontosra az erózió, főleg nem több mint ezer példányban. A híres marsi arc valóban emlékeztet emberi arcra, de jóval elnagyoltabb, nem ismétlődik, ráadásul a Marson nem él és valószínűleg nem is élt (humanoid) civilizáció, ezért az UFO-hívőkön és az összeesküvés-elméletek rajongóin kívül senki se gondolja, hogy intelligencia alkotta, pedig megtehette volna. Nem jut eszembe a nevük azoknak a kő oszlopoknak, melyek tetején egy másik fajta kő egyensúlyoz, pl Etiópiában van ilyen. Az emberek régen erre intelligens okot kerestek, hogy óriások tették rá a sziklát, pedig ma már tudjuk, hogy az erózió koptatta le a szikla alatta puhább kőzetet évmilliók alatt. Persze ember is lehetett volna, gépekkel. Hasonlóan termeszvár-szerű képződményt ember is létrehozhatna, de az erózió is külsőleg hasonlót. Az űrben ezért keresnek a Húsvét-sziget szobraival egyenrangú prímszámokat, míg a szintén komplex, akár élet vagy intelligencia által létrehozható marsi arcnak, kőoszlopnak vagy termeszvárnak megfeleltethető elektromágneses jelek felett átsiklanak, hisz ezek tévútra vihetnek.
    Szóval a gondolkodásbeli különbség. A probléma az, hogy a nyelvet és operációs rendszert hasonlítotok az élet kódjához. Mindkettő a materiális valóságban gyökerezik: hangképző szervekre van szükség, közvetítő közegre (levegő) illetve áramkörökre, tranzisztorokra, elektronokra, de a jelentésük már független ettől. A szavak nem tükrözik a jelentésüket, csak az agyunk kapcsolja össze, ezért is létezik annyiféle nyelv. Az informatikában is a bináris kódhoz mi rendeljük a jelentést, mi állítjuk fel a logikai kapukat, a parancsaink, a jelentésük, az adott válasz teljesen független a fizikai világban megjelenő formától. A virtuális világban mi állítjuk fel a játékszabályokat, csak a számítás zajlik a valóságban. Bármelyik billentyűhöz bármelyik betűt hozzárendelheted vagy akármi mást, egy kinyíló ajtót vagy hogy küldjön a világűrbe jelet. A biológia viszont teljesen mértékben a valóságra támaszkodik, a fizikára és a kémiára. Egy fehérje-rész azért ágyazódik be a membránba, mert hidrofób aminosavak alkotják. Egy enzim azért hasítja el a célpontját, mert az aminosavai megbontják a peptid-kötést. Ha egy fehérje olyan szerkezetet vesz fel, melybe cink épül be, akkor így alkalmassá válhat a nukleotidok megkötésére és transzkripciós faktorként működik, melynek egy egy másik része, mely olyan aminosavakat tartalmaz, megköti az RNS-polimerázt megfelelő alegységét. A fehérjék funkciója szükségszerűen a fizikai-kémiai tulajdonságaiktól függenek, az azokat felépítő atom tulajdonságaitól, melyek összessége, kötésük módja határozza meg a molekula tulajdonságait. Ha 18-20 hidrofób és neutrális aminosav egymás mellé kerül, akkor ez a rész transzmembrán lesz és a így a membránhoz köti a fehérje többi részét, ami tartalmazhat mondjuk egy fehérje-hasító motívumot és így egy transzmembrán proteázt kapunk. A fehérje egyéb részei magukhoz vonzhatnak más fehérjéket, így azok szállíthatják oda azt a célpontot, amit hasítani tud. A funkció a molekula tulajdonságaitól függ, ahogy a vízben is az oxigén funkciója az, hogy kötésbe lép 2 hidrogénnel. Ez a víz aztán nagy tömegben hegyeket vájhat ki, kialakíthat völgyeket vagy akár a Grand Canyont is, feltárva földtörténeti rétegeket, létrehozva egy gyönyörű komplexitást. Istenen kívül senki se gondolta volna, hogy az a vízmolekula a Grand Canyont fogja kivájni, amikor 5-10 milliárd évvel ezelőtt fúzióval létrejött egy csillag belsejében. A molekulák viselkedése, szerepe adott közegben determinált. A tRNS molekulát a szerkezete determinálja arra, hogy melyik aminosavat ragadja meg. A nukleotidoknak csak egy szerepe van: a kód. Minden génnek ugyanaz a szerepe: információhordozás. A dezoxiribóz csak a vázat adja, a struktúrát, de maga a kód, a bitek, a nukleotidok is a valóságban vannak, és fizikai-kémiai tulajdonságuk határozza meg, hogy a polimeráz hogyan olvassa le és a polimeráz fizika-kémiai paraméterei határozzák meg, hogy mit köt: a megfelelő RNS nukleotidot.
    Remélem át sikerült adnom miért téves a nyelvhez vagy operációs rendszerhez hasonlítani a DNS kódot. Az atomok, molekulák, csillagok világa áll közel hozzá. Egy csillagból jövő elektromágneses özön milyen elképzelhetetlenül komplex és gyönyörű szimfónia lehet hangra átalakítva, azt hihetnénk, hogy egy őrült zseni lázálomszerű szüleménye.

  • Szabados Ádám says:

    Lima Rui,

    három dolgot keversz össze egymással a hozzászólásodban.

    1) Összekevered a komplexitást és a funkcionálisan specifikus komplexitást. Intelligenciára nem a komplexitás, hanem a nagy mennyiségű, funkcionálisan specifikus komplexitás kapcsán következtetünk. Itt írtam a különbségről. Egy tintapaca vagy egy kristály komplex forma, amit irányítatlan anyagi folyamatok is létrehoznak. A Marson egy egyszerű mintázat is az, ahogy a tengerparton egy szmájlinak látszó minta is az lehet a homokban. Egy írás vagy egy kód viszont funkcionálisan specifikus komplexitás, amit irányítatlan anyagi folyamatok nem hoznak létre, és ezt ösztönösen tudjuk is, mert ez az egyöntetű tapasztalatunk.

    2) Összekevered az információt és az információhordozó eszközt. Az információ nem anyagi létező. Az információ hordozója viszont anyagi létező. A nyelv először gondolat, csak utána betű- vagy hangsor. A DNS-ben (sőt, a sejtben, epigenetikai szinten!) lévő információ nem anyagi természetű, csak annak megnyilvánulása az. Képzelj el egy hűtőmágnessel kiírt feliratot, mondjuk azt, hogy SZERETLEK, DÓRA! A felirat anyagi formában testesül meg, de az információt magát nem a fizika vagy a kémia határozza meg. Olvasd el Polányi Life’s Irreducible Structure c. esszéjét, ami pont erről szól, vagy ezt a cikkemet a jelentés és a működés szükségszerű hierarchiájáról! Az információ soha nem lehet szükségszerű (fizikailag és kémiailag determinált), mert lényegét tekintve kontingens, a lehetőségek leszűkítése.

    3) Összekevered az intelligens ok detektálását és az intelligens ok azonosítását. Nem szükséges tudnunk, hogy mi az intelligens ok, amelynek a jelét észleljük, ahhoz, hogy az intelligens okot magát észleljük. W. Dembski leírta az intelligens ok detektálásának matematikai modelljét The Design Inference c. könyvében (Cambridge University Press, 1998). Az, hogy az adott intelligencia ember, földönkívüli vagy Isten, az intelligencia azonosításának, nem pedig észlelésének kérdése. A Húsvét-sziget szobrai azért jó példák, mert ott fogalmunk sincs arról, hogy ki az alkotó, csak valószínűsítjük, hogy ember lehetett (én is ezt tartom messze a legjobb hipotézisnek). Te azért nem akarsz intelligenciára következtetni az élet rendszerei kapcsán, mert ebben az esetben ember nyilvánvalóan nem lehetett az ok, tehát olyan lényre kellene következtetned (hacsak a földönkívüliek szerepét nem tekinted lehetséges hipotézisnek), akinek a létezésében nem hiszel. Ezt nevezem én a materialista (vagy naturalista) kényszerzubbonynak. Miközben észlelhetjük az intelligens okot, kizárod mégis a lehetőséget, mert olyannal kellene azonosítanod, amit tagadsz. Csakhogy ez már nem tudományos érv, hanem metafizikai előítélet. Teistaként nekem Isten létezése a világnézetem egyik legfőbb alapvetése, ezért semmi problémát nem jelent a teremtő intelligencia észlelésekor ennek az intelligenciának az azonosítása. Nincs rajtam a naturalista kényszerzubbony.

  • Lima Rui says:

    „Összekevered az információt és az információhordozó eszközt. Az információ nem anyagi létező. „ Pont erről beszéltem, hogy itt van egy fontos értelmezésbeli probléma. Igen, a nukleotidok hordozzák az információt, de ez az információ nem más, mint maguk az aminosavak! Anyagi létezők! Az aminosavak sorrendje határozza meg a fehérjét, melynek funkciója van. A fehérje is anyagi létező. A fehérje egyenlő a funkcióval, a fehérje aminosav sorrendje hordozza magában az utasítást és ezt a 20 (22) féle elsődleges aminosav (és a módosulásaik) karaktere határozza meg. A ciszteinek egymás közt disulfid hidat képeznek, mely stabilizálja a fehérjét, így ezek ellenállóak lesznek a külső hatásokkal szemben. A leucin, izoleucin, metionin hidrofób, így be tudnak épülni a hidrofób lipid membránba. „While hydrophobic amino acid residues build up the core, polar and charged amino acids preferentially cover the surface of the molecule and are in contact with solvent due to their ability to form hydrogen bonds (by donating or accepting a proton from an electronegative atom). Very often they also interact with each other: positively and negatively charged amino acids form so called salt bridges, while polar amino acid side chains may form side chain-side chain or side chains-main chain hydrogen bonds (with polar amide carbonyl groups). „
    A Polányis cikkedel kapcsolatban is van pár alapvető értelmezésbeli tévedés, ami nem feltétlenül Polányi hibája, főleg, hogy ő, ahogy említed, nem sokkal a DNS kettős hélix felfedezése után írta az esszéjét (mint ahogy sok általad említett és idézett nagyszerű tudós, pl Wigner is, a molekuláris biológia hajnalán volt aktív). „Az A, T, G, C molekulákból álló nukleotid bázisok sorrendje ugyanis nem függ a kémiai kötés erejétől. Bármilyen sorrendben összeállhatnak, semmilyen kémiai folyamat nem határozza meg, hogy milyen sorrendet képezzenek.” Ez így van. Viszont azért idézem, mert a fontos, hogy bázisok meghatározzák, hogy milyen bázis áll velük szemben (A-T/U, G-C), így a DNS meghatározza az RNS-t a transzkripciónál, illetve a jóval bonyolultabb tRNS-ekben is meghatározó ez a bázispárosodás, így a tRNS struktúrája meghatározza az aminosavét a transzláció során. A Candida CUG kodonja leucin helyett szerint kódol egy a CUG kodont felismerő tRNS-ben történt mutáció miatt. Nukleotid analógok (https://en.wikipedia.org/wiki/Nucleic_acid_analogue ) is be tudnak épülni a DNS-be/RNS-be, melyek nem feltétlenül követik az A-T/U, C-G bázispárosodás szabályait, mutációt hozva létre. A nukleotidok kémiai karaktere igenis meghatározza az információt. Elképzelhetőek más nukleotidok vagy más aminosavak is az élőlényekben, más kombinációban (létrehoztak olyan működő genetikai kódot, melyet 6 különböző nukleotid alkot), de a DNS-RNS-fehérje közti információtovábbítást illetve átalakítást, akkor is a (bio)kémia határozza meg.
    Az idézet folytatása: „Ez a sorrend azonban meghatározza a funkciójukat.” Így van. Viszont a funkció is visszahat a sorrendre: ha torzulás történik, akkor elpusztulhat a sejt, vele együtt az információ, illetve akár javulhat is, elterjesztve a sikeres mutációt, vagy maradhat minden a régiben. Visszatérve az előző idézetre: „Bármilyen sorrendben összeállhatnak, semmilyen kémiai folyamat nem határozza meg, hogy milyen sorrendet képezzenek.” Pontosítok: közvetlenül nem határozza meg, de közvetve igen. Ha a bázisok olyan sorrendbe állnak, ami értelmetlen fehérjét kódol vagy olyat ami nem látja el a szükséges kémiai (!) funkciót, akkor ez a sorrend nem marad fent, elpusztul az egyeddel együtt. (Ne felejtsük el, hogy a fehérjéknek kémiai funkciója van.) Így kapcsolódik össze az információ a funkcióval, melyeket az ezeket hordozó molekulák fizikai-kémiai karaktere határoz meg. Ezek nem választhatóak el egymástól, az információ igenis anyagi létező ebben az esetben. És ugyanúgy igaz ez az epigenetikára is: a kromatin szerkezete vagy a promóter metilációja meghatározza, szabályozza a nukleotidok kémiai hozzáférhetőségét a polimeráz számára.
    „Polányi rendkívül fontosnak tartja a tényt, hogy a kémiai törvények nem határozzák meg a nukleotidok sorrendjét. Ha ugyanis meghatároznák, eltűnne az információ. Mindig ugyanaz ismétlődne, a redundancia pedig az információt a nullához közeli értékké redukálná.” Habár, ahogy írtam a kémiai közvetetten hat a nukleotidok sorrendjére, sőt, meghatározza azt, a kémiát befolyásolja a természetes szelekció. Ahogy írod: „a DNS-ben tárolt nagy mennyiségű információt nem a fizika és a kémia törvényei határozzák meg (noha azok által működik), hanem valamilyen felsőbb szint kontrollálja.” „az egész egységet egy feljebb való szintről irányítja (pl. természetes szelekció). „ A természetes szelekció nem egy önmagában álló erő. Az a környezet, biotikus és abiotikus, a ragadozók, kompeptítorok, a hozzáférhető táplálék, éghajlat, stb, állandóan, ciklikusan vagy random jelentkezve. Ezekre reagál az élőlény, méghozzá a funkcionális végrehajtói, a fehérjék által, illetve ez is mind visszahat az élőlény biokémiai állapotára. Az az élőlény, melynek a fehérjekompozíciója, térben és időben, megfelelően válaszol a környezet kihívásaira, a szelekciós ágensekre, az fennmarad, így csatol vissza a kémiai a nukleotidok sorrendjére.
    A szelekció hat az élőlényre (biokémiára, fehérjékre), konkrétan szelektál a megfelelőek között, azaz szelektál a megfelelő biokémiájú, megfelelő fehérje-kompozíciójú élőlények között, így azok továbbörökítik ezt a megfelelő kompozíciót, melyet a megfelelő DNS nukleotid sorrend kódol. A nukleotid sorrend folyamatosan mutálódik, minden faj minden egyedében más és más, így más a fehérje-összetétel is, máshogy reagálnak a környezetre, ki jobban, ki kevésbé. A sikeresebbek több utódot hoznak létre, így gyakoribbá válik a megfelelő fehérje-összetétel és így az azt kifejező nukleotid sorrend is. A DNS kód a fehérjéken keresztül alkalmazkodik a környezethez, reagál rá, és a környezet visszacsatol a DNS-re úgy, hogy általa kiválogatódnak a megfelelő fehérje-összetétellel rendelkező élőlények. Így lesz teljes az egész. Ez a rendszer emeli ki többek között a biológiát a kémiából, és konkrétan a visszacsatolás általi működés különbözteti meg az élőlényt (vagy replikont) egy fehérje (molekula) halmaztól.

  • Szabados Ádám says:

    Lima Rui,

    “you completely miss the point” – mondaná az angol. Leírod, hogy a DNS kódja hogyan funkcionál, amikor az RNS molekulával összekapcsolódva aminosavakat hoz létre (amelyekből ugye az aminosavak típusa és sorrendje alapján bonyolult geometriai alakzatokban fehérjék keletkeznek, amelyek a fehérjeszintézis folyamatában is – ki tudja hol tárolt információ által vezérelve – részt vesznek). Ez azonban mind irreleváns abból a szempontból, hogy a kód hogyan jött létre. Az információ eredete a kérdés, nem annak funkcionális működése.

    Aztán leírod, hogy környezeti hatások hogyan hatnak a kódra, amivel egyrészt lamarcki útra tévedsz, amelyet kategorikusan tagad a neo-darwinista szintézis (szerzett tulajdonságok a Modern Szintézis szerint nem öröklődnek), másrészt legjobb esetben is arra adsz ezzel választ, hogy az információ időnként hogyan módosul, arra nem, hogy hogyan jött létre. (Ez pedig visszavezet ahhoz a korábbi kérdéshez is, hogy mi az, amit kísérleti úton ténylegesen tudunk az evolúcióról, és mi az, ami csak fiktív extrapoláció. Nálad ez a kettő rendre keveredik.)

    Az pedig, hogy a kód fizikai hordozón jelenik meg (a DNS esetében ez a cukorfoszfát gerinchez kapcsolódó nukleotidok láncolata, valamint az epigenetikai szinteken tárolt információ, amely nem a DNS-molekula bázissorrendjéből következik, hanem magából a sejtből), ugyanúgy nem teszi az információt fizikai-kémiai szükségszerűséggé, ahogy a hűtőmágnessel kiírt üzenet sem teszi a mágnesességet felelőssé az üzenet sorrendjéért (sem az, hogy az üzenet milyen szociális funkciót tölt be). Egy számítógépes szoftver kódjának elektromos jelei sem teszik az információs kódot a hardver fizikai-kémiai folyamatai termékévé, hiszen a kódot nem a hardver hozza létre, az csak megtestesíti. A jelentés és a működés szintjei nem azonosak. Erről szól Polányi cikke, amit semmilyen új felfedezés nem cáfolt, nem is tudna cáfolni, hiszen filozófiai kérdés ez, ami nem avul el. Olyan, mint az, hogy 2×2=4, vagy hogy A ≠ nem-A. Akármennyit is tudunk a sakk szabályairól, az nem fogja megmagyarázni, hogy miért pont azokat a lépéseket tette a sakkjátékos, amelyeket tett. A két dolog egyszerűen más szinteken helyezkedik el. Az információ eredete a kérdés, nem annak működése.

  • Lima Rui says:

    “Az pedig, hogy a kód fizikai hordozón jelenik meg, ugyanúgy nem teszi az információt fizikai-kémiai szükségszerűséggé, ahogy a hűtőmágnessel kiírt üzenet sem teszi a mágnesességet felelőssé az üzenet sorrendjéért (sem az, hogy az üzenet milyen szociális funkciót tölt be).” A kód=fehérje=funkció. Szelekció kiválasztja a túlélő egyedet, mely szaporodik. Egyed=összefehérje=összfunkció=genom. Mutáns gén=mutáns kód=mutáns fehérje=mutáns funkció–>pl nő a fitnesz–>egyed sikeres–>sok kis egyed.–>A mutáns kód elterjed. Ha a mutáns kód csökkenti a fitneszt, az egyed elpusztul, lemarad. A szelekció választja ki a megfelelő egyedet=funkciót=megfelelő fehérjét=megfelelő kódot. Kiválasztja, nem létrehozza. A szelekció visszahat a kódok összességére, kiválasztja a megfelelőket. Térben elkülönül az öröklődő(!) információ a végrehajtó információtól, ami a fehérje, de köztük a kapocs kémiailag rögzített. A fehérje funkciója a molekuláris összetételétől függ. A molekuláris összetétel a DNS kódtól függ. Az élőlény életben maradása a jól működő funkcióktól függ, a fehérjéktől, amik meg a DNS kódtól. A siker visszacsatol a DNS-re, így az is fent marad. A még sikeresebb DNS elterjed az egyre több egyedben. A DNS betűsor függ attól, hogy amit kódol az jól funkcionáljon. A kód (DNS) anyagi forma, a végrehajtó funkció (fehérje) anyagi forma, ezeket a kémia köti össze. A gén azt mondja, hogy vágd el az X molekulát. A DNS által kódolt fehérje elvágja azt, mert olyan aminosavakból áll, melyek képesek elvágni az X molekulát. Az X molekula elvágásával az egyed tápanyaghoz jut, életben marad. Ha mutáció révén a mutáns fehérje hatékonyabban vágja X-et, akkor csökken a szelekciós nyomás, hisz könnyebben elérhető a táplálék, a mutáns fehérjét kódoló egyed több utódot hoz létre, így elterjed a mutáns fehérjét kódoló mutáns gén. Visszacsatolás történik, hogy a kód jó. Itt minden az anyagi világban van. Mi nincs? Hasonlatok nélkül.
    “Akármennyit is tudunk a sakk szabályairól, az nem fogja megmagyarázni, hogy miért pont azokat a lépéseket tette a sakkjátékos, amelyeket tett.”
    A másik sakkjátékos a szelekció, a lépései a szelekciós ágensek. Azok magyarázzák meg miért lépett úgy a mi sakkjátékosunk. De a hasonlat rossz, mert a sakkjátékosok tudatosan cselekednek. Azért is rossz, mert nekünk rengeteg sakkjátékosunk van (a populáció tagjai), mindegyik máshogy lép (mutáció) és velük szemben egy sakkzseni áll, akinek az eszköztára ugyan behatárolt (szelekciós ágensek a lépéslehetőségek), de az idő neki kedvez. De ne menjünk bele, hisz rossz a hasonlat. Minden hasonlat rossz, hisz csak hasonlat, sohase lehet tökéletes és nem egyezik azzal, amiről szó van.

  • Szabados Ádám says:

    Lima Rui,

    a válaszodban megint az információ működéséről beszélsz, nem annak eredetéről. Viszont annyiban informatív számomra a kommented, hogy megtudtam belőle, hogy a környezeti hatásokat mégis neo-darwinista, nem pedig lamarckista módon értelmezed. Ezzel persze lemondasz arról, hogy a véletlen mellett a környezet is befolyásolja a mutáns változatok létrejöttét, ami az érvrendszeredet teljes mértékben kiteszi annak a matematikai problémának, amit a fenti cikkben leírtam. Az is kiderült számomra a kommentedből, hogy az embert fizikalista módon írod le. Ez az emberkép számomra nem csak valószínűtlen, de teljesen abszurd is, kb. olyan, mintha a lejátszott zongoradarabot a zongora billentyűivel magyaráznád. A materializmus szükségszerű csődjét látom ebben a magyarázatban, amikor a valóságot próbálja értelmezni.

    A sakkal kapcsolatos érvet is félreérted, és az a gyanúm, hogy ez éppen a fizikalista szemüveg miatt lehet. Megpróbálom még egyszer elmondani, miről van szó. A sakk azért analóg a DNS-ben lévő információval (a hasonlatot nem én találtam ki, hanem Polányi, aki Einstein tanítványa volt), mert bemutatja, hogy a fizikai-kémiai törvények nem lehetnek az információ magyarázatai. Az információ a lehetőségek leszűkítése, egyfajta felsőbb szintű kontroll (Polányi szóhasználata), amely az alsóbb szintű kontroll által létezik, de nem az által meghatározott. A sakklépések a sakk szabályai szerint történnek, de nem a sakk szabályai határozzák meg azokat, hanem a sakkozó elméje. A sakk szabályai iszonyatosan sok kombinációt tesznek lehetővé, mégis mindig egy bizonyos kombináció valósul meg a sok lehetséges kombináció közül. És mindig másik. Ezt a bizonyos kombinációt a sakk szabályai kontrollálják, de nem létrehozzák. Ezért beszélünk információról: az információ ugyanis a lehetőségek leszűkítése.

    A DNS kódjával ugyanez a helyzet. A fizika törvényei által jelenik meg, de nem a fizika törvényei hozzák létre. A sorrendet nem a kémiai kötések határozzák meg, de azok által létezik. A sorrend lehet tetszőlegesen egészen más is (mint ahogy ezt tapasztaljuk is), azt eredendően nem határozzák meg a kémiai és fizikai törvények. Ha meghatároznák, nem lenne sokféle DNS, a DNS elveszítené információhordozó szerepét. Ugyanúgy, ahogy a sakk is elveszítené az érdekességét, ha csak egyfajta lépéssorozatot tenne lehetségessé, mert mondjuk a lépéseket a szabályok determinálnák.

    A kérdés ezért az, hogy honnan van az az információ, amely a nukleotidok bázissorendjének különböző, egészen valószerűtlen kombinációi által a 22 aminosavat pont olyan sorrendben állítja elő (felsőbb – epigenetikai – szinten irányított fehérjék segítségével, ami a fizikalista számára még milliószor-milliószor nehezebbé teszi a kérdést), hogy az éppen azokat a fehérjéket szintetizálja, amelyek az élet működéséhez kellenek. Nem az a kérdés, hogy hogyan működik ez a kód, hanem az, hogy honnan van. A véletlen (vagy véletlen és szükségszerűség valamilyen kombinációja) esetén olyan matematikai valószínűségről lenne szó, amelynek esélyei messze-messze meghaladják a lehetséges határait. Mintha egy speciális csúzlival az univerzum legtávolabbi pontján egyetlen atomot kellene egyetlen próbálkozással vaktában eltalálnod. Mondjuk egymás után csilliárd alkalommal. (Ezen a természetes szelekció nem segít, hiszen az már a találat után hirdet téged győztesnek, nem előtte.)

    A vizsgált kísérletekben azt látjuk, hogy az evolúció nem új információt hoz létre, hanem a meglévőben hoz létre változást. A klorokvin-rezisztencia kialakulása például úgy jelent meg, hogy a DNS-ben lévő információ leromlott, és miközben a védekezésben előnyt hozott a parazita számára ez a romlás, más területen funkcióvesztéssel járt. Pont úgy, mint ahogy ma reggel a teáskanna, amiből a forró vizet kiöntöm. Három hete frusztrál, hogy a teáskannába épített szűrő miatt lassan tudom csak kiönteni belőle a forró vizet. Ma reggel megörültem, mert azt vettem észre, hogy meggyorsult a vízáramlás. Mikor megnéztem, mi az oka ennek, észrevettem, hogy szétfoszlott belül a szűrője. Ez előnyt jelentett abban, hogy gyorsabban tudom kiönteni belőle a vizet, de valójában nem új dolog épült, hanem egy régi funkció romlott el (nem szűri többé a vizet). Ilyen dolgokat figyelünk meg a valós idejű evolúcióban, nem pedig új, funkcionálisan specifikus, komplex információ létrejöttét, ami az élőlények működéséhez kell. Utóbbit minden tapasztalatunkban intelligencia hoz létre.

  • Veszt says:

    Sziasztok!

    Szintén biológus vagyok. Már megszerzett Ph.D fokozattal. Szakterületem a nitrogén anyagcsere egyik kulcsenzimjének vizsgálata volt növényekben. Jelenleg kukoricanemesítés területén dolgozok.

    Annyit szeretnék csak a témához hozzáfűzni, ami reflexió Ádám utolsó gondolatait is, hogy a megfigyelt “hasznos” mutációk nagyon nagy része tényleg defektus és a mutáns egy sokkal energia igényesebb utat működtet ami korábban is létezett, de mivel nem volt érdemes használni nem is használta. A másik fajtája a mutációknak a gén duplikálodassal függ össze. Itt sem egy új információ jön létre hanem a meglévő sokszorozódik ez által nyújtva jobb kondíciót az élőlénynek, bár talán ez áll legközelebb az információ létrehozásahoz.

    A másik dolog ami ide kapcsolódik az a nemesítés témája: azt gondolnánk ha máshol nem akkor itt tényleg az evolúció mesterségesen irányított és gyorsított folyamata zajlik. De nem. A nemesített élölényekben is csak a már meglévő információk újra kombinálása és tisztítása történik. Új információ nem jön létre. A mesterséges mutagenezis során is csak gének tönkre tétele történik.

    Biológusként azt látom hogy az új információ kialakulására nincs bizonyíték csak az elv hogy marad a véletlen és az idő, másként nem történhetett, ezért ez történt még akkor is ha ennek a valószínűsége egyenlő a nullával.

  • Lima Rui says:

    Na, már csak ez hiányzott nekem, egy eretnek 😛
    Még majd kifejtem, hogy mit nem értett meg Ádám korábban az írásomból, de addig belinkelem ezt a cikket:
    http://criticalbiomass.blog.hu/2016/09/19/soreleszto_haziasitas
    (Amúgy érdemes követni ezt a blogot.)
    A cikkben szépen egybevág minden, az adaptáció a rézhez vagy a kénhez, a különböző körülményekhez. Érdekes keveréke a természetes és mesterséges szelekciónak.
    “Mint más élőlények esetében is, az állandó környezet génvesztéshez vezetett. Ezeknek az élesztőknek a genomja sok helyen “elsatnyult”, gyakran egész kromoszómákat vesztettek el. Számos sörélesztő a klonális szaporodás miatt elvesztette a szexuális szaporodási képességét is”
    Ez azért már több, “mikroevolúció”. Vagy abba belefér egy egész kromoszóma elvesztése? De a lényeg, hogy azok a vonalak, melyek már csak ivartalanul képesek szaporodni nem alkotnak szaporodóképes populációt a többi élesztővel. Ezek már tekinthetőek külön fajnak. Persze zűrös a faj fogalma, főleg az ivartalanul szaporodó “populációknál”, “fajoknál”: https://hu.wikipedia.org/wiki/Faj , de azért van ilyenre példa: http://www.ng.hu/Termeszet/2004/01/Evmilliok_ota_ivartalanul_szaporodik_egy_kulonleges_allatfaj

  • Szabados Ádám says:

    Lima Rui,

    érdekes, hogy pont egy olyan példát hozol, ami alátámasztja a fenti érvemet.

    A nemesítés és a háziasítás lehetőségét és tényét senki nem tagadja. Hogy a sörélesztő esetében ezt mikroevolúciónak nevezzük-e vagy sem, az nem lényeges, az a lényeges, hogy amit megfigyeltünk, az gének romlásával vagy elvesztésével járt. Ez megint arra példa, hogy a vak természet képes információt rombolni, adott esetben úgy is, hogy az valamilyen területen előnyt jelent. Ha egy számítógépes kód egy részét véletlenül (vagy a véletlent imitálva szándékosan) megsemmisítjük, lehet, hogy a gép gyorsabb lesz, lehet, hogy egyes feladatokat máshogy fog megoldani, de nem új információ keletkezett, hanem a régit vesztettük el.

    Egy kromoszóma elvesztése a sörélesztő esetében újabb aromák létrejöttét jelentette, de éppen a biokémiai folyamat ismeretéből tudjuk, hogy ez nem új információ keletkezésével történt, hanem információ elvesztésével. Ezzel bizonyos korlátokon belül akár jelentős előnyt is lehet szerezni (gondolj arra, mennyivel könnyebb betenni a biciklit a csomagtartóba, ha levesszük a kerekét!), de nagyon messzire nem lehet vele eljutni. (M. Behe szerint az evolúció akár átlépheti a faj taxonómiai határait is, de a rend határait már szinte biztosan nem tudja átlépni.)

    Arra mutass példát, hogy az evolúció új, funkcionálisan specifikus információt hozott létre! Információ elvesztésére nagyon könnyű példát találni, hiszen irányítatlan anyagi folyamatok nap mint nap ezt csinálják. Nem az a csoda, hogy nehezen találunk épen megőrzött kéziratokat a természetben, hanem az, hogy egyáltalán találunk, hiszen a természet pusztítja az információt, nem építi. Tornádó le tud rombolni egy egész házat, de olyat még nem láttunk, pedig ez lenne a nagy szám, ha megépítene egyet. Ha kiveszed egy könyv utolsó fejezetét (mondjuk véletlenül kiszakadnak az utolsó lapok), egészen más történetet kaphatsz. Lehet, hogy a szomorú vég helyett vidám vége lett így a könyvnek, vagy vidám helyett szomorú. A könyv érdekesebbé is válhatott, vagy éppen – nagyobb valószínűséggel – bénább lett a befejezés. Még az is elképzelhető, bár kicsi a valószínűsége, hogy a könyv éppen emiatt lesz bestseller. A véletlen új könyvet viszont nem fog írni. Látod a különbséget?

    Arra mutass példát, hogy a vak természet új, funkcionálisan specifikus információt hozott létre! Ne extrapolált történetet mesélj arról, hogy a neo-darwinista modell szerint mi történt évmilliókkal ezelőtt, mert az pusztán feltételezés, hanem megfigyelt kísérletet mutass meg, ahol ez a szemünk előtt végbement. Mondjuk arra mutass egy példát, hogy egy kromoszóma nem elveszett, hanem keletkezett! (A neo-darwinizmus szerint ennél sokkal többre kellett képesnek lennie az evolúciónak, csak kell, hogy legyen most már példa arra, ennyi évtized intenzív vizsgálódás után, hogy egy jelentéktelen kis új kromoszóma természetes úton megépült… Persze ha így lenne, nem kellene Lenskinek még mindig azokkal a bacikkal vacakolnia a laboratóriumban, hogy valami áttörő eredmény végre mutatkozzon.)

  • Lima Rui says:

    „Ne extrapolált történetet mesélj arról, hogy a neo-darwinista modell szerint mi történt évmilliókkal ezelőtt, mert az pusztán feltételezés, hanem megfigyelt kísérletet mutass meg, ahol ez a szemünk előtt végbement. Mondjuk arra mutass egy példát, hogy egy kromoszóma nem elveszett, hanem keletkezett!”
    Szóval miközben tudjuk, hogy az evolúció (ha létezik) igen lassú folyamat, te egy a szemünk előtt (!) végbement kromoszóma-keletkezést (!) szeretnél. Vannak igényeid. „csak kell, hogy legyen most már példa arra, ennyi évtized intenzív vizsgálódás után, hogy egy jelentéktelen kis új kromoszóma természetes úton megépült” Úgy látom, nem fogod fel igazán, hogy miről is van szó. Rengeteg a korlát és valójában jóval kevesebben foglalkoznak azzal, hogy az evolúciót bizonygassák, mint ahogy te azt hiszed. Azért összefoglalom miért nem reális a kívánságod: 1) Az evolúció lassú, ezer-millió években mérendő. 2) Az ember halandó, ráadásul a genetika se olyan régi tudomány, így a leghosszabb kísérlet is csak pár évtizedes lehet (60 év a max, amit eddig találtam, ami 1500 Drosophila generáció, ami 30 ezer évnyi emberi fejlődés. Az ember 60 ezer éve hagyta el Afrikát és azóta még mindig egy faj vagyunk.) 3) A laborkörnyezet nem olyan, mint a természet. Többnyire állandó a környezet és a 1 szelekciós ágens, ez inkább a genom redukciónak kedvez. 4) Mutációk folyamatosan keletkeznek, de ezeknek kis része növeli a fitneszt, főleg ha állandó a környezet, mint a laborban. Potenciálisan rengeteg olyan mutáció keletkezhet (pozitív is!), ami nyom nélkül eltűnik, mivel az állandó laborkörülmények között nem jelent előnyt. 5) A kromoszómaszám változás vagy a kromoszómális régiók átrendeződése jóval nagyobb horderejű, mint egy pontmutáció vagy egy gén duplikációja, deléciója, akár több száz vagy ezer gént is érinthet, így jóval nagyobb arányban letális.
    Na, nézzük a medvét.
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4173774/pdf/mBio.01377-14.pdf
    Fontos szem előtt tartani, hogy egy kromoszóma, melyen több tucat, száz vagy ezer gén is van, nem keletkezhet csak úgy. A leggyakoribb oka egy régebbi kromoszóma kettéválása, esetleg megduplázódása.
    Az is fontos, hogy baktériumról lévén szó, ne várjunk kromoszóma duplázódást 25 év alatt, ha az még 3 milliárd év alatt se következett be. Bár úgy látom, te Lenskitől elvársz. De azért kiemelek pár dolgot a cikkéből.
    „We combined optical mapping and genome sequencing to identify chromosomal rearrangements that occurred in each of 12 populations during 40,000 generations of experimental evolution. We detected a total of 110 rearrangements, of which 75% were deletions, 17% were inversions, and 8% were duplications. However, the resolution of the optical mapping did not allow the detection of many small deletions and insertions, including new IS element insertion events.” Érthető a sok deléció, hisz a környezet állandó volt. „many chromosomal regions were repeatedly affected by similar rearrangements in two or more populations.” Tehát nem véletlen esemény. „one region was duplicated in three populations, and it spans an ~11-kbp region containing 14 genes, including rpoS, which encodes the alternative sigma factor involved in the transition into stationary phase” Ez a 14 gén 3 független vonalban is duplikálódott. Valószínűleg a dupla rpoS kompetíciós előnyt jelentett az átmenetkor az exponenciális és stacioner fázis között, ami naponta megtörtént ezen körülmények között. „some new IS insertions occurred in genes that were mutated in many or all of the LTEE populations, and that genetic parallelism strongly suggests that these insertions were also beneficial” „IS elements, by providing a substrate for homologous recombination, played the predominant role in large-scale rearrangements that restructured the genomes during this long-term experiment. IS elements have also been shown to contribute to genomic plasticity in other studies, including both evolution experiments in the laboratory and analyses of natural isolates„ Összefoglalva: The rearrangements thus discovered had substantial effects on the size and structure of the chromosome, demonstrating the impressive plasticity of bacterial genomes. Several lines of evidence, including parallel changes observed in independently evolving populations, suggest that at least some of the rearrangements conferred higher fitness in the experimental environment.”
    Ráadásként, bár ezek nem illeszkednek a szigorú követelményeidhez:
    Habár nem derül ki a mutáció mibenléte, de mindenképpen érdekesek: http://listverse.com/2011/11/19/8-examples-of-evolution-in-action/
    Van itt előnyös információszerzés bőven.
    60 évig sötétben nevelt legyek:
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4751556/pdf/365.pdf
    Az 1283 mutálódott génből mindenféle szűrés után kiválogattak „84 genes carrying SNPs or InDels in these regions of the Dark-fly genome. We suggest that these genes are potentially strong candidates for those involved in Dark-fly’s adaptation” Miután felsorolt konkrét mutációkat „, these candidate genes might be related to unusual pheromone synthesis and/or perception in Dark-fly” Az eredményeik alapján „Dark-fly females might detect some specific cues, such as odors or sounds, to discriminate partners in the absence of visual cues”. Úgy tűnik a fellépett mutációk következtében a légy adaptálódott a párválasztáshoz a sötétben. Circadian ritmust befolyásoló gének is változtak, de ezt nem tesztelték.
    Kis kiegészítés, konkrétan a cikkedhez: Igaz, még nem teljesen felderített és csak SNP-ről van szó, de a tasmán ördög csupán 4-6 generáció alatt elkezdett adaptálódni a harapással terjedő rák ellen. Valószínűleg 2 génről vagy az egyikükről van szó, bár további 5 is szóba jöhet. http://www.nature.com/articles/ncomms12684#supplementary-information
    3 kis belterjes populáció és nagyon erős szelekciós nyomás. 2 populációban 4, egyben 6 generáció alatt elkezdett rezisztencia kialakulni. A matematikai modell szerint ez lehetetlen lenne. Vagy a modell vagy a valóság bizony hibás.
    A végére még külön kiemelem ezt az idézetet tőled, annyira tetszik: „Ne extrapolált történetet mesélj” 🙂 (Nem részletezem.)

  • Szabados Ádám says:

    Kezdem a végén: tényleg szerencsétlenül megfogalmazott mondat volt, nem is védem.:)

    Természetesen nem vártam el, hogy egy kromoszóma kialakulására példát hozz, hiszen egyrészt tudom, hogy nincs, másrészt tudom, hogy milyen iszonyatosan lassú változásokat tudnak felmutatni a valós idejű kísérletek (illetve megfigyelések). Arra akartam csak rámutatni, hogy az evolúciónak nem elveszítenie, hanem felépítenie kellett kromoszómákat, ezért egy kromoszóma elvesztése az ég világon semmit nem bizonyít a feltételezett makroevolúciós folyamatokból. Információt bármikor el tud veszíteni a természet, a létrehozása a kérdés. Az élővilágban irdatlan mennyiségű komplex, funkcionálisan specifikus információról beszélünk, genetikai és epigenetikai szinteken egyaránt.

    Viszont azt érdemes tisztázni, hogy pusztán természettudományos alapon csak azt tudjuk, amit kísérleti vagy egyéb úton megfigyelhettünk. A drozikkal kapcsolatos kísérletek fontosak, az adaptációval kapcsolatos megfigyelések is fontosak, a rezisztencia megfigyelt kialakulása is fontos. Csak ezeket senki nem tagadja, sőt! A genom plaszticitásának megfigyelése pusztán azt igazolja, hogy a genom képes változásra. Hogy milyen határokon belül, na az az igazán izgalmas kérdés! Vajon határtalan ez a plaszticitás? Nem úgy tűnik.

    Behe The Edge of Evolution c. könyvében részletes biokémiai érvekkel és megfigyelt kísérletekkel támasztja alá azt a véleményét, hogy az evolúció olyan, mint egy héliumos léggömb. El tud emelkedni a földtől, de nem tudja elhagyni a Föld légkörét. Képes változásokat előidézni, de határokon belül. A határtalan plaszticitás soha nem nyert igazolást. Amit látunk, az a változékonyság (és az azon belüli esszenciális stabilitás) évezredek óta ismert ténye. A változékonyságot extrapolálva gondolja a neo-darwinista evolúcióelmélet, hogy a diverz élővilág egyetlen közös őstől származott, fokozatos átmenet révén. Viszont ez már a történetmesélés része az elméletnek, ami nem tudományosan igazolt, és amivel szemben óriási a kétely és rengeteg az ellenérv.

  • Szabados Ádám says:

    Ahogy fent is említettem már, a paleontológiai leletek pedig ugye kezdettől inkább óriási problémát jelentenek Darwin elmélete számára. A fosszíliák mintázata egyszerűen nem azt mutatja, mint amit kellene, ha a darwinista gradualizmus igaz volna. Nem kicsi az eltérés. Hallottam paleontológust, aki egyértelműen kijelentette, hogy ha Darwin ma élne, és látná az azóta megismert mintázatot, nem lenne darwinista. (Darwin arra számított, hogy az idő meg fogja oldani az általa is észlelt problémákat. Ezek a problémák azóta nem hogy nem oldódtak meg, de kifejezetten akuttá váltak.) Ezt csak azért említem, mert a változékonyság és a szelekció múltba vetítésével elmesélt grandiózus történet plauzibilitását ez a tény rendkívüli módon tovább gyengíti.

  • Lima Rui says:

    Erről a tényről jó lenne egy link. Lehetőleg tudományos cikk.

  • Szabados Ádám says:

    Belinkelek néhány forrást.

    Itt van egy rövid cikk arról, hogy az első évtizedekben hogyan fogadták Darwin elméletét paleontológusok: Darwin & Paleontology: 50 years of conflict.

    Itt egy összefoglaló cikk, amelyben minden állítás mögött ott van egy kikereshető hivatkozás, amely tudományos szaklapokban megjelent cikkekhez illetve a témában releváns könyvekhez vezet: Problem 5: Abrupt Appearance of Species in the Fossil Record Does Not Support Darwinian Evolution.

    Itt egy rövid összefoglaló cikk a konfliktusról (idézetekkel és illusztrációval): Conflicts Between Darwin and Paleontology.

    Stephen C. Meyer Darwin’s Doubt c. könyve a kambriumi robbanás problémáját mutatja be. A könyvet a borítón a következő szavakkal ajánlja Dr. Mark McMenamin, számos rangos szakmai díjjal kitüntetett paleontológus, a The Emergence of Animals c. könyv társszerzője, a kambriumi időszak szakértője: „Nekünk, paleontológusoknak, akik a darwini elemzési hagyományban merültünk el, nehéz elismernünk, hogy a kambriumi robbanás neo-darwinista magyarázatai csúfos kudarcot vallottak. Az elmúlt években szerzett új adatok nemhogy megoldották volna Darwin dilemmáját, inkább súlyosbították azt. Meyer világosan és pontosan írja le a probléma nagyságát. A könyve alapjaiban változtatja meg az evolúció tanulmányozását és a helyes irányba terel bennünket az állatok eredetének új elméletének keresésében.” (Meyer könyvéről itt írtam.)

    A Darwin’s Dilemma c. dokumentumfilm látványos képekkel és illusztrációkkal, a kambriumi időszak szakértőinek a közreműködésével mutatja be, hogy a kambriumi robbanás mekkora problémát jelent Darwin elmélete számára. (A belinkelt youtube videó sajnos pocsék minőségben, orosz felirattal teszi elérhetővé a remek kisfilmet, de a semminél talán ez is jobb.)

    És a végére két idézet:

    1) Az egyik legismertebb 20. századi paleontológus, Stephen Jay Gould mondta 1980-ban a sokat idézett mondatot, hogy a neo-darwinista szintézist nem támogatják a bizonyítékok, és lényegében halott, annak ellenére, hogy a hithű tankönyvekben még mindig jelen van (“Is a new and general theory of evolution emerging?” Paleobiology, 6(1): 119-130 (1980)). Gould evolucionista volt, de elvetette a neo-darwinista elméletet annak gradualizmusa miatt, aminek szerinte egészen nyilvánvalóan és makacsul ellentmond a paleontológia.

    2) Géczy Barnabás magyar paleontológus írja Lamarck és Darwin (Magvető, 1982) c. könyvében: „Darwin állandó apró változásokra építő graduális felfogása nem egyeztethető össze a mai őslénytan tényeivel” (152).

    A sort folytathatnám.

  • Szabados Ádám says:

    Ezt az interjút mindenkinek ajánlom megnézésre. Minimum elgondolkodtató.

  • jgabor says:

    Kicsit líraibb vizekre evezve:
    A zeneakadémián az első zenetörténet órát így kezdte a tanárunk (Kovács Sándor – zenetörténész): „Hölgyeim és Uraim! A tudomány mai állása szerint a zene kialakulásáról nem tudunk semmit!” Aztán felvázolta a lehetséges elméleteket és azzal zárta: „Nagyon úgy tűnik, hogy ez a dolog bele van programozva az emberbe.”

  • Szabados Ádám says:

    Amikor az egyetemen neurolingvisztikát tanultam, a tanár mutatott nekünk egy ábrát, ahol egy emberi alak az idegvégződései száma alapján volt eltorzítva. Az ember szinte csak egy nagy kéz és egy nagy arc volt. Amikor elmagyarázta a prof az ábrát, mellékesen megjegyezte: „Olyan, mintha az embert eleve kommunikációra és munkára teremtették volna!”

    Az emberi nyelv léte persze amúgy is nagyon komoly – egyesek szerint megoldhatatlan – kihívást jelent a darwinizmus számára. Nem véletlen, hogy az író Tom Wolfe éppen ezt látja a darwinizmus Achilles-sarkának, és hogy a darwinistává és ateistává megtérő A. N. Wilson a zene és a nyelv miatt nem tudott végül ateista és darwinista maradni: Pálforgás – A. N. Wilson: egy hívőből lett ateistából lett hívő.

  • dzsaszper says:

    Kedves Lima Rui,

    az információ működéséről vs. keletkezéséről, a Polányi féle kettős meghatározottságról:
    az információ maga ugyanaz, csak más formában jelenik meg, ha egy fájlt merevlemezre, CD-re, pendrivera, floppyra vagy akár lyukkártyára írok, vagy ha kézzel lejegyzetelem a hexa kódot.

    Ami a DNS-ben szereplő aminosav sorrendet illeti, az az információ kódolása, nem maga az információ.
    Ne ragadjunk feltétlenül le az aktuális kódolás szintjén.

    Szóval nem sikerült átadnod, miért tartod tévesnek a nyelvhez hasonlítani a DNS kódját.
    Amióta tudjuk, hogy a genom egyes szakaszai azt kódolják, hogy más szakaszok mikor aktiválódnak, azóta a DNS leginkább egy programozási nyelvre hasonlít.
    (Bár a DNS, mivel fehérjéket kódol, a szemantikai tartománya a fehérjemolekulák köre, egy leheletnyit speciális. De akkor is a kódolt fehérjemolekulák az érdekesek információ szempontjából, ha más információ hordozó lenne, és valami más élet ugyanúgy létre tudná hozni a fehérjéket, elműködhetne.

  • dzsaszper says:

    Kedves Lima Rui,

    Szóval miközben tudjuk, hogy az evolúció (ha létezik) igen lassú folyamat, te egy a szemünk előtt (!) végbement kromoszóma-keletkezést (!) szeretnél. Vannak igényeid.

    azért összefoglalom miért nem reális a kívánságod

    Én úgy látom, hogy az igények nem Ádám, hanem a tudományfilozófia igényei.
    És innentől nem látom, hogy az extrapolációs elméletnek mi köze a természettudományhoz, és azt, hogy bármilyen módon falszifikálható lenne.

  • Lima Rui says:

    dzsaszper és Ádám!
    “Ami a DNS-ben szereplő aminosav sorrendet illeti, az az információ kódolása, nem maga az információ.”
    Ezt leírtátok jó sokszor, értem is én. De hogy egyértelmű legyen: mi az információ, amit kódol? Mi “maga az információ”? Példával lehetőleg, hogy egyértelmű legyen. És akkor konkrétabban el tudom magyarázni, hogy én miről beszélek.

  • dzsaszper says:

    Kedves Lima Rui,

    amennyire értem, a DNS által kódolt információ elsősorban alacsony szinten a szintetizálandó fehérjéket kódolja, és azt, hogy mit milyen körülmények között kell kódolni (aktiváció és deaktiváció).

    Elképzelhető, hogy ezen kívül további szemantikája is van a DNS-nek, ami egyelőre nem ismert, és elképzelhető, hogy a kódolt fehérjéken keresztül, több szintű információ van jelen (metaprogramozás a fehérjeszintézisen keresztül).

  • Lima Rui says:

    “Én úgy látom, hogy az igények nem Ádám, hanem a tudományfilozófia igényei.
    És innentől nem látom, hogy az extrapolációs elméletnek mi köze a természettudományhoz, és azt, hogy bármilyen módon falszifikálható lenne.”

    A kontinens-vándorlást, hegységek kialakulását, bolygók keletkezését elhiszed? Vannak bizonyítékok, megfigyelések is, de akkor is ez mind extrapoláció.
    “Szóval miközben tudjuk, hogy az evolúció (ha létezik) igen lassú folyamat, te egy a szemünk előtt (!) végbement kromoszóma-keletkezést (!) szeretnél. Vannak igényeid.”
    Hogy érzékeld: Ádám hegységképződést szeretett volna 30 év alatt, laborkörülmények között.

  • Lima Rui says:

    “amennyire értem, a DNS által kódolt információ elsősorban alacsony szinten a szintetizálandó fehérjéket kódolja, és azt, hogy mit milyen körülmények között kell kódolni (aktiváció és deaktiváció).”
    Tehát akkor a fehérje az információ? A fehérje funkciója az információ? Pl. hogy X fehérje elvágja Y fehérjét? Hogy X fehérje Z szövetben termelődjön? Hogy X fehéjre a citoszólban vagy a membránban működjön? Hogy X kötődjön A-hoz, majd B-hez? Ez lenne az információ, amiről beszéltek?
    (A DNS többi funkciója a fehérje-szint alatt van, főleg azok expressziójának szabályzása, illetve szintén fehérjéken keresztül fehérjék módosítása)

  • Szabados Ádám says:

    Lima Rui,

    többször leírtam fent az információ egyik definícióját: az információ a lehetőségek leszűkítése. Shannon dolgozta ki az információ elméletét, mégpedig úgy, hogy az kvantifikálható legyen. Egy számsor például komplex információ, hiszen minden egyes helyen egyetlen szám áll, pedig más számok is állhatnának ott. Az információ komplexitása attól függ, hogy a lehetőségeket milyen mértékben szűkíti le.

    A funkcióspecifikus információ, ami a fehérjekódoló exonok esetében a DNS-ben (no meg epigenetikai szinteken máshol is a sejtben) van, nem csak a lehetőségek leszűkítése, hanem annál sokkal több. Ez a típusú információ úgy szűkíti a lehetőségeket, hogy az valamilyen funkció ellátásához (valamilyen mintához) illeszkedik. A példa pedig legyen mondjuk a PIN-kód. A kód négy számból áll, amelyek mindegyike a tízes számrendszeren belül van (tehát mindegyik szám lehet 0, 1, 2, 3, 4, 5, 6, 7, 8 vagy 9). Azért funkcióspecifikus ez az információ, mert a számok kinyitják azt, amit más számsor – legyen bár ugyanolyan komplex – nem nyit ki.

    A funkcióspecifikus információ nagy mennyiségben (mint amilyen pl. egy PIN-kód) kizárja a véletlen ráhibázás lehetőségét (vagy legalábbis a reális valószínűség Borel által meghatározott matematikai határain kívülre helyezi). Az első szám eltalálásához 1^10 az esélyed. Elég kicsi. A másodikhoz ugyanekkora, de ha a kettőt együtt kell eltalálnod, a valószínűség drámaian romlik. Na most egy négy számjegyű kód esetében annyira lecsökken a valószínűség, hogy valószínűleg akkor sem fogod véletlenül eltalálni, ha a következő öt évet azzal töltöd, hogy próbálkozol. A kód eltalálásához információra van szükséged. A lehetőségek leszűkítésére.

    Na most egyetlen egyszerű – mondjuk 150 aminosavból álló – fehérje adott kombinációban való megépülésének valószínűsége kb. 10^195, ami nagyságrendekkel nagyobb szám, mint amennyi becsült elektron van az egész univerzumban! Az élet spontán keletkezése jól hangzik, amíg matematikusok nem néznek rá az esélyekre. A Wistar szimpóziumon aztán ezt megtették, és sokan nevetve fordultak el a neo-darwinista fikciótól. A darwinista E. O. Wilson pedig azt mondta, hogy inkább tartsuk távol a matematikát a biológiától.

    A hegyek felépülésének példája jó is meg nem is. Jó azért, mert rámutatsz általa a különbségre, ami a kísérleti és a történeti tudományok között van Utóbbiak – ahogy dzsaszper korábban a kriminalisztikával összehasonlítva jelezte is már – máshogy bizonyítanak, mint a kísérleti tudományok. Abduktív módszerrel dolgoznak, vera causa után kutatva. Ez az, ahol darwinisták szerint Darwin elmélete jól teljesít, a kritikusok szerint viszont rettentő gyatrán. A hegyek hasonlata azért rossz viszont, mert egy hegy kialakulása és egy funkcióspecifikus információ létrejötte között nagyjából az a különbség, mint hogy az íróasztalodról a szél hirtelen lefújja a tolltartót, vagy hogy a napsütés és a szél (meg akármilyen más természeti erő) egyszercsak ráfesti Leonardo Utolsó vacsoráját az asztalodra.

    De hogy ne maradjon félreértés: nem kérem, hogy egy kromoszóma megépülését demonstráld. Arra utaltam a nyilvánvalóan abszurd kérésemmel, hogy nagy mennyiségű funkcionálisan specifikus információt semmilyen formában nem hoz létre a természet, miközben annak elvesztése (pl. egy kromoszómáé) gyakran megtörténik. Ahhoz, hogy a neo-darwinista evolúcióelmélet kicsit is plauzibilisebbnek tűnjön, demonstrálnia kellene, hogy a természet meg tud építeni funkcionálisan specifikus rendszereket vagy kódokat.

  • Szabados Ádám says:

    Tehát akkor a fehérje az információ? A fehérje funkciója az információ?

    Az az információ, hogy pl. az aminosavak milyen sorrendben és geometriai alakzatban épüljenek egymásra, hogy egy sajátos kombinációjú fehérje jöjjön létre, amely képes az élettani feladatok ellátására. Az információ az, amely a csillagászati nagyságrendű kombinációs lehetőségeket pont arra szűkíti le, amely egy funkcionális fehérjét tud aminosavakból összeállítani. (És persze több szintű információról van szó, nem csak a DNS nukleotidjainak sorrendjéről, hiszen a sejt együttműködve, fehérjék segítségével, epigenetikus információ vezérletével végzi el a fehérjeszintézist.)

  • Lima Rui says:

    Ádám:
    Imádod a hasonlatokat. Egy példát kérnék, hogy mit értesz a biológiában információ alatt.
    “A funkcióspecifikus információ, ami a fehérjekódoló exonok esetében a DNS-ben (no meg epigenetikai szinteken máshol is a sejtben) van, nem csak a lehetőségek leszűkítése, hanem annál sokkal több. Ez a típusú információ úgy szűkíti a lehetőségeket, hogy az valamilyen funkció ellátásához (valamilyen mintához) illeszkedik. A példa pedig legyen mondjuk a PIN-kód.”
    Legyen a PIN-kód helyett más a példa. Biológiai.

  • dzsaszper says:

    Kedves Lima Rui,

    Tehát akkor a fehérje az információ? A fehérje funkciója az információ? Pl. hogy X fehérje elvágja Y fehérjét? Hogy X fehérje Z szövetben termelődjön? Hogy X fehéjre a citoszólban vagy a membránban működjön? Hogy X kötődjön A-hoz, majd B-hez? Ez lenne az információ, amiről beszéltek?

    Tegyünk egy kört az alapvető informatikai és nyelvtani fogalmakhoz: jel, jelzett, jelentés…

    A szintetizálandó fehérje ugyebár a jelzett dolog. Az aminosavkombináció pedig a jel.
    Az információ a jelnél és a jelzett dolognál több. Egy adott kontextusban értelmezhető jel, amelynek a jelzett dologgal való kapcsolata a kontextusban felismerhető.
    Az információ tehát egy adott környezetben — expresszió szabályozást is tartalmazó — parancs valamilyne fehérje kódolására.

    Ahogyan az adathordozóra írt fájl esetében is: az információ mondjuk egy üzenet, amit X küldött Y-nak. A bitek az adathordozón a jel, és adott a kontextus (az adathordozó olvasási szabványaitól a fájlrendszeren át az ASCII vagy UTF-8 etc. kódig) amiben a jelek értelmezhetőek.

  • Szabados Ádám says:

    Legyen a PIN-kód helyett más a példa. Biológiai.

    ??? Az információ nem biológiai vagy földrajzi vagy csillagászati, hanem matematikai fogalom. A legnyilvánvalóbb példa, ahogyan az információ a biológiában megjelenik, éppen a DNS kódja.

  • Lima Rui says:

    Akkor tisztázzuk a dolgokat.
    Maga a PIN-kód hordozza az információt a telefon kinyitásához. A PIN kód funkciója az információ hordozása, míg az információ specifitása a funkció: a telefon kinyitása. Funkcióspecifikus információt hordoz a PIN-kód. Lényegében ebben az esetben az információ és a funkciója (a telefon kinyitása) nem választható el egymástól. Az információnak többféle manifesztálódása is lehet a különböző PIN-kódok formájában, ahány telefon annyiféle PIN-kód, de mindegyiknek ugyanaz a funkciója: a telefon kinyitása. Nem az 1234 vagy az 6743 az információ maga, hanem az hogy: nyisd ki a telefont.
    Jól látom?

  • Szabados Ádám says:

    Egy konkrét PIN-kód (mondjuk az én bankkártyámé) négy egymást követő számjegye olyan kód, ami a funkcionalitástól függetlenül is információ, hiszen a lehetőségek leszűkítése erre a négy betűre, ebben a sorrendben. Ez relatíve komplex információ, de funkcionális specifikussága csak a bankszámlámhoz való hozzáférés kapcsán van.

    A DNS kódját (pl. GTACCATTA) át lehetne írni más kódnyelvre is, de funkcionális specifikussága a fehérjék kódolásában van. Véletlenül ilyen komplex információ nem lesz funkcionálisan specifikus, mert ennek a probabilitása meghaladja a reálisan elképzelhető határait.

  • dzsaszper says:

    A PIN kód a már használhatatlanul bugyuta példa. (Kit érdekel egy ilyen, pofonegyszerű reguláris kifejezéssel leírható nyelv amiben az égvilágon semmi nyelvi struktúra nincs az ABC-n és a mondat hosszán kívül?)

  • Szabados Ádám says:

    A kombinációs lakat példáját már unom, azért választottam a PIN-kódot.:) A nyelv analógiáját is elhasználtam. A programnyelvét pedig te.:) De valóban: a PIN-kód totál lebutított analógiája annak az információs kódnak, ami a sejtekben van.

  • Lima Rui says:

    A DNS kódról készül az RNS bázispárosodással, amiről meg a fehérje a tRNS-ek révén (itt is jelentős a bázispárosodás). A fehérje aminosav sorrendje és az aminosavak kémiai karakterisztikája határozza meg a fehérjét, a szerkezetét és a funkcióját is. A kód és az általa kódolt funkcióspecifikus információ között fizikai-kémiai kapcsolat van. Ez se a PIN-kódra, se az op rendszerekre, se a nyelvekre nem igaz. Ezek asszociációk. Viszont a fehérje funkciója determinált, az összetétele határozza meg, ami a DNS-be van kódolva, illetve az összetevők (aminosavak) fizikai-kémiai jellemzői, amit a polimerázok és a tRNS-riboszóma komplex biztosít, melyek szintén a DNS-be vannak kódolva. (Lehetnének persze más aminosavak is, akkor a rendszer azoknak a fizikai-kémiai tulajdonságaihoz illeszkedne.) A fehérje funkciója nem asszociáció eredménye, nem csak úgy hozzá van rendelve, mint egy 4 számjegyű kódhoz a funkció, vagy hogy a „szeretet” szó a szeretetet jelöli, de semmi kapcsolat nincs köztük, csak az, hogy aki érti, az asszociál rá.
    A másik irányból is van kapcsolat, bár ez már nem egyértelmű és nem kizárólagos. Hogy a fehérje helyesen láthassa el a funkcióját, ahhoz a kódnak helyesnek kell lennie. Megértjük ha egy külföldi a „seretetről” beszél „szeretet” helyett, a funkcióját ellátja. A fehérjékre ez nem igaz. (Habár a fehérjék is elbírnak ilyen hibákat, mutációkat vagy allelikus eltéréseket, de csak akkor ha az nem érinti a funkciót.) Ha rossz a kód, akkor rossz a fehérje, így a fehérje nem látja el a funkcióját és az egyed, melyben mindez jelen van, elpusztul és így a hibás kód is eltűnik. Módosulhat a kód vagy javulhat is, így a fehérje funkciója is módosul vagy javul, ha az egyed előnyére válik, akkor sok utódja lesz, melyeknek mindezt átadja, természetesen a kóddal együtt. Egyértelmű kémiai kapocs is van a kód egyes részei között és a funkció között, amit kódolnak: a polimerázok, tRNS-riboszóma komplex értelmezi a kódot, ha nem látják el helyesen a funkciójukat, akkor rosszul értelmezik a kódot: módosulhat a kód (DNS polimeráz hibája) vagy módosulhat a kód információ tartalma (RNS polimeráz hibája, tRNS-ek mutációja, promóter hibája). A DNS kódol egyéb fehérjéket is, mely a többi fehérje funkcióját módosítja.
    Egy példa a valóságból:
    TTACAA…AAGGTG…CAGGGTGAATCAAGATGAAAAAC…
    TTA a promóter utolsó 3 nukleotidja. CAA…AAG az 5’ UTR (a … X db nukleotidot jelent), GTG…CAG az intron az 5’ UTR-ben, GGTGAATCAAG az 5’ UTR maradék része, majd az ATG jelenti a metionint, a transzlálódó fehérje első aminosavát. Az 5’ UTR benne van éretlen és érett mRNS-ben is, de nem transzlálódik. Az intron már az érett mRNS-ben nincs benne. Az első GT jelöli az intron első 2 nukleotidját, míg az utána jövő AG az intron ultsó 2 nukleotidját. Ez konzervált, minden eukariótánál így van (minden intron eukariótában van, de nem minden eukariótában van intron. valamint mitokondriumban, kloroplasztiszban sosincs intron). Az RNS-polimeráz kémiailag kötődik a promóter megfelleő régiójához, TATA-box, minden ami kell, elkezdi a transzkripciót a CAA-tól. Ha az intron GT-jében vagy az AG-jében az egyik nukleotid megváltozik (pontmutáció) vagy hibáz a polimeráz (előfordulhat), akkor a splicing során nem vágódik ki az intron és így a transzláció az intronban lévő ATG-ről (nincs jelölve, …-ban van) indul, értelmetlen fehérjét adva. Láthatjuk, hogy a DNS nem csak kód, hanem funkcióspecifikus információ is: a promóter, benne a transzkripciós faktor kötőhelyekkel, valamint az intron/exon határ, ezt ismeri fel a spliceosoma az éretlen mRNS-en. Az emberi DNS csupán 1%-a kódol fehérjéket. Ha az ATG-ben mutáció történik, akkor a transzláció a következő ATG-nél kezdődik (nincs az ábrán), értelmetlen lesz a fehérje. Ha az ATG után kiesik 1-2 nukleotid vagy beillesztődik, akkor szintén értelmetlen fehérje lesz. Az emberi DNS 3 milliárd nukleotidból álló betűsor, melynek csak akkor van értelme, ha a DNS helyes, hisz akkor képződnek helyes funkciójú fehérjék, melyek értelmezni tudják az egészet. A DNS kémiailag determinálja a fehérje funkcióját, de a normál fehérje-funkció nélkül a DNS se értelmezhető, így nem is helyes. A DNS által hordozott információ funkcióspecifitását a DNS hordozza kémiailag, illetve az aminosavak hordozzák kémiailag, és a 2 között kémiai kapocs van. A PIN-kód, az op rendszer és a nyelv hibás analógia, azok asszociációk, míg a DNS kódrendszer nem az, az ugyanis adott környezetben fizikailag-kémiailag determinált. Ilyenen kódot nem ismerünk, tudomásunk szerint nincs (max egy másik élő bolygón), máshogy működik mint az ember-alkotta kódok, ezért nem is hasonlítható össze. Mivel a ti példáitokban leírt kódokat az ember alkotta, az intelligens ember, ezért arra következtettek, hogy egy hasonló kódot is intelligenciának kellett alkotnia. Csakhogy a DNS-kód nem hasonló, teljesen más. A DNS-kódra leginkább az atomok és molekulák szerkezete hasonlít: az oxigén atomot 8 elektronja arra determinálja, hogy 2 elektron felvételével stabilizálja magát, így alkot vizet 2 hidrogénnel. A víznek további tulajdonságai vannak, melyekből funkció következik, hasonlóan, ahogy a fehérje tulajdonságaiból következik annak funkciója. A fehérje se „akar” egy lipidmembránon átnyúlni, de a szerkezete, tulajdonságai miatt ezt teszi. A víz nem „akar” közeget biztosítani minden élő sejt és élőlény számára, de kémiai tulajdonságai miatt (semleges pH, kiváló oldószer, folyékony 0-100 fok között, stb) ezt teszi. A protonok, neutronok és elektronok által hordozott információ teszi őket alkalmassá a megfelelő atom létrehozására, mely ezen információk alapján kapcsolódik más atomokkal, létrehozva vegyületeket, melynek mások a tulajdonságai, mint az alkotó atomoknak. A különbség lényegében annyi, hogy míg a kémiában a kód és a funkció fizikailag egyben marad (atom és molekula), addig a biológiában nem (DNS és fehérje). A feltételezett RNS-világban viszont szintén egy volt/lett volna a kettő és ribozimek most is léteznek. Tény hogy az RNS kémiai tulajdonságai alapján tud kapcsolatot létesíteni a DNS és fehérje között. A funkcióspecifikus információt hordozó és a funkciót végrehajtó ribozim összeköthette a DNS-t és fehérjét, majd különválhatott a kód és a funkció, hisz ezek hordozására alkalmasabbak a DNS illetve a fehérje. Talán az se véletlen, hogy ribozimek vannak a riboszóma RNS-fehérje kimére komplexben, mely a transzlációt végzi és igen konzervált.

  • Szabados Ádám says:

    Lima Rui,

    elmondom, miért részben irreleváns, részben pedig téves, amit leírtál. Egyrészt irreleváns információval szórtad tele a hozzászólásodat. Ne érts félre, fontos dolgokat írtál le a fehérjeszintézisről, de ezek a köztünk lévő vitát semmilyen szempontból nem befolyásolják, valójában nem is érintik. Ugyanis megint azt mondtad el, hogy hogyan működik (és időnként módosul) a DNS-ben lévő információ, nem azt, hogy hogyan jött létre. Olyan, mintha a nyelvi kód kapcsán elemezted volna a szintagmák egymással való kapcsolatát, a szövegkohéziós elemeket, rámutattál volna az anaforákra és kataforákra, és végül elvégezted volna a szavak szemantikai elemzését, majd kijelentenéd, hogy ezekkel megmagyaráztad a szöveg eredetét.

    Azzal, hogy írtál a DNS és az RNS bázispárosodásáról, a fehérjék aminosavakból összeálló alakzatairól, a fehérjeszintézisben az RNS polimeráz és az mRNS együttműködéséről, a promóterek és a polimeráz lehetséges hibáiról és ezáltal a kód változásairól, semmit nem mondtál arról, hogy honnan van az az elképesztően specifikus és funkcionális, rendkívül komplex információ, amit a DNS tárol. Az általad elmondottak egyike sem ad erre magyarázatot, hiszen már adottnak veszed a DNS kódját, amelyhez kapcsolódnak az mRNS-ek, hogy fehérjék és tRNS segítségével az aminosavakból újabb funkcionális fehérjéket építsenek.

    Másrészt téves is, amit mondasz, hiszen az információt nem az RNS-sel való bázispáralkotás határozza meg, hanem magának a DNS nukleotidjainak a sorrendje. (Az epigenetikai szintű információt most nem veszem figyelembe, csak jelzem, hogy az még nagyságrendekkel megnöveli a DNS-kód információjának funkcióspecifikus komplexitását.) Az RNS az információ átírását és fordítását végzi. Ezért irreleváns a vitánkban mindaz, amit a fehérjeszintézisről mondasz. És ami még fontosabb: a nukleotidok sorrendjét nem determinálja semmilyen kémiai kötés, hiszen tetszőleges sorrendben helyezkedhetnek el a cukorfoszfát gerincen. (Ha nem így lenne, a DNS nem érne semmit, hiszen az információhordozó képessége minimálisra csökkenne. A kontingencia – vagyis a nem-determinisztikus jelleg – teszi a DNS-t alkalmassá arra, hogy betöltse fiziológiai szerepét.)

    Ha megnézed egy DNS molekula kémiai szerkezetét, azt látod, hogy a nukleotid bázisok (A, G, T, C) teljesen azonos kémiai kötéssel kapcsolódnak a cukorfoszfát gerinchez. A kötés szempontjából nincs különbség abban, hogy adenin, guanin, citozin vagy timin bázisról van-e szó. Mindegyik bázis N-glikozidos kötéssel kapcsolódik a deoxiribóz cukorhoz, nincs affinitásbeli különbség, ami valamelyik purin vagy pirimidin bázist preferálná a másik helyett. Bármelyik bázis ugyanolyan eséllyel kapcsolódhat a gerinchez. Egymással viszont a láncon egymás mellett elhelyezkedő nukleotid bázisoknak nincs közvetlen kémiai kapcsolatuk! „A nukleinsavak olyan tulajdonsággal rendelkeznek, hogy kémiai szempontból a DNS bármely kombinációs mintája egyenértékű.” (Bernd-Olaf Küppers)

    Hogy miért lényeges ez? Azért, mert az információ nem a DNS és az RNS kapcsolatában van, hanem a nukleotidok bázissorrendjében! Az RNS a DNS által meghatározott sorrendben olvassa le az információt. A bázispárképzés szabályai szerint az adeninnel szemben mindig uracil, a timinnel szemben mindig adenin, a citozinnal szemben mindig guanin és a guaninnal szemben mindig citozin áll. A nukleotidok sorrendjét viszont nem kémiai kapcsolat határozza meg, hanem valami más. És éppen ettől tud a DNS hallatlanul komplex információt hordozni!

    Megdöbbentő, lenyűgöző a sorrend funkcionális specifikussága. Hogy ez honnan van, az a biológia legnagyobb kérdése, amire nincsen válasz. Még Dawkins szerint sincs, pedig ha valaki, ő biztosan szeretné, hogy legyen válasz. Az, hogy a transzkripció során a polimeráz vagy a promóter hibákat ejt, nem új információs lánc létrejötte, hanem csak a meglévő módosulása (szinte mindig romlása). A DNS nukleotid bázisainak elképesztően komplex, funkcionálisan specifikus sorrendjének eredete a kérdés. Ez pedig lényegében maga az élet és a biokomplexitás létrejöttének kérdése. Olyan funkcióspecifikus, teleológiai rendszereket működtető komplex információról beszélünk, amely egyetlen eukarióta esetében is sokkal-sokkal lenyűgözőbb, mint egy iPad vagy egy helikopter működését biztosító információ funkcióspecifikus komplexitása.

  • Szabados Ádám says:

    És hogy a fehérjeszintézis kapcsán milyen irdatlanul összetett, integrált, ezer és ezer összehangolt lépésből álló folyamatról beszélünk (messze azon az információn felül, amit a DNS kódja hordoz, az RNS pedig lefordít!), abból itt egy kis ízelítő. Teljes képtelenség, hogy ilyen bármiféle véletlen, illetve irányítatlan anyagi folyamat révén létrejöjjön (vö. Wigner J.: „a kémiai evolúció lehetetlen”).

  • dzsaszper says:

    Kedves Lima Rui,

    ami a fizikai-kémiai tulajdonságokat illeti, egy CD tulajdonságai sem függetlenebbek mint a fehérjék a DNS nukletoidjaitól. Hogy most RNS transzkripció van vagy egy CD-olvasó fér hozzá az információhoz, az az információ tulajdonságai szempontjából lényegtelen.

    Ami a hibatűrést illeti, a DNS egy programkódhoz hasonló. Ha épp a kommentet gépeled el, a működés szempontjából nem lesz jelentősége… sőt, ha mázlid van az érdemi kódot is el tudod írni úgy, hogy a végeredmény nem változik…

    mert az információ nem a DNS és az RNS kapcsolatában van, hanem a nukleotidok bázissorrendjében.
    Pontosan! A nukleotidok az ABC betűi, amelyekből szavakat/mondatokat/bekezdéseket/szövegeket tartalmazó DNS-ek építhetőek össze.
    Ha ezt ilyen jól látod, nem értem, miért jössz a fizikai-kémiai tulajdonságok egyediségével. Az a történet a biológia, biológiai kémia, biológiai fizika szempontjából érdekes, de a DNS információtartalma szempontjából csak az eszközt jelenti, a fordítóprogramot amely a DNS kódot fehérjék szintézisére fordítja.

  • Szabados Ádám says:

    mert az információ nem a DNS és az RNS kapcsolatában van, hanem a nukleotidok bázissorrendjében.

    Ez a mondat tőlem származik, pont arra válaszként, amit te is szóvá teszel Lima Rui kommentjében.

  • Lima Rui says:

    „Ugyanis megint azt mondtad el, hogy hogyan működik (és időnként módosul) a DNS-ben lévő információ, nem azt, hogy hogyan jött létre.”
    Habár megint erről írsz, de én meg sem próbáltam a DNS kód keletkezéséről írni. Nyilvánvalóan erről még nem tudunk eleget és amit tudunk, az neked nem elég. Én arra próbáltam rávilágítani, hogy a hasonlataitok a nyelvvel és egyéb kódokkal mennyire nem áll közel a DNS-kódhoz.
    „És ami még fontosabb: a nukleotidok sorrendjét nem determinálja semmilyen kémiai kötés, hiszen tetszőleges sorrendben helyezkedhetnek el a cukorfoszfát gerincen.”
    Ezzel tisztában vagyok. Azt próbáltam az előzőekben kifejteni, hogy habár a sorrend tetszőleges, a funkció amit kódol létszükséglet, hogy megfelelően működjön, így a kód maga, ami az élőlényekben van nem tetszőleges (persze sok helyen az, ez lenne a junk DNS vagy egyéb nem fontos szakaszok). Potenciálisan a sorrend tetszőleges, de ebből egy olyan kombináció valósul meg, mely az adott életképes élőlényt adja ki. Illetve milliónyi, milliárdnyi kombináció, ahány faj illetve egyed van. Egy egyszerű példa: ATG (start) után természetesen állhat TAG (stop), áll is biztos sok esetben, de ha egy fehérjekódoló régió így kezdődik, akkor abból nem lesz fehérje, így ez nem is marad fent, csak nem kódoló szakaszokon. Hasonlóan felléphet bárhol mutáció, de ha elrontja a fehérje funkcióját, akkor az egyed elpusztul és a kódja nem marad fent. Így az évmilliárdok alatt csak olyan DNS kódok, csak olyan nukleotid sorrendek maradnak fent, melyek megfelelően kódolják a fehérjéket. Ettől még persze változhat a kód.
    „A nukleotidok sorrendjét viszont nem kémiai kapcsolat határozza meg, hanem valami más. „ Ez a más az én olvasatomban a természetes szelekció, amit lényegében az előzőekben fejtettem ki. A nyelveknél a szavak és jelentésük között nincs más kapcsolat, csak az emberi asszociáció. A DNS kód és a fehérjék között egyértelmű kémiai kapocs van. A természetes szelekció lényegében a fehérjékre hat, a megfelelő fehérje-kompozíciót választja ki, így a megfelelő kódot. A nyelveknél nincs ez a kapcsolat, a fejlődésükben is részt vesz szelekció, de az önkényes. A nyaktekerészeti mellfekvencből nyelvújíthatsz nyakkendőt, ugyanazt fogja jelenteni, és a nyakköndőt ugyanúgy fogod megkötni, ugyanaz marad a funkciója. A DNS kódnál ez már teljesen mást fog jelenteni, lehet hogy elpusztul a mutáns egyed, így marad minden a régiben. Vagy kialakul egy új tulajdonság, új funkció. Az operációs rendszereknél már direktebb a kapcsolat, de ott az ember rendeli a funkciót a kódhoz, a logikai kapukkal, különböző parancssorokkal. Ugyanaz az X db bit egy programban mást fog jelenteni, mint egy másikban, a programozótól függően. A DNS bitekhez az aminosav részprogramok hozzárendelése kizárólagos, univerzális (ahol nem, ott mutáció van a tRNS-ekben). Továbbá az op rendszerekre csupán mesterséges szelekció hat, és ilyen egy biológiai lénynél, még a kutyáknál sincs. Ezért rosszak a hasonlataitok. Sőt, ha ezekből a hasonlatotokból indultok ki és ezért kerestek intelligenciát a DNS kód mögött, akkor tévútra kerültök. Ettől még lehetne intelligencia mögötte, de nem ezen funkcióspecifikus információk miatt, hisz az egyik alma, a másik körte.
    Nézzük másképp. A lándzsa funkcióspecifikus információ. Egy díszesen faragott acélhegyű példányt nyilván intelligencia teremt. Az intelligens csimpánzok is használnak lándzsát, sőt, csinálnak is: letörik a fáról és élesre harapdálják. Tanult viselkedés. Valószínűleg az első csimpánzok és emberősök is az első lándzsaként használt botokat viharok után találták, amiket a szél letört a fákról, éleket, hegyeket hozva létre. Biztos előfordult olyan, hogy egy állat magától felnyársalódott egy éles boton, mintha az lándzsa lenne. Éles botok azóta léteznek, mióta fák vannak, de lándzsa csak akkor lett, amikor elkezdték tudatosan annak használni. Jól látom? Tipikus, emberi kategorizálás. Egy éles bot információ, de egy éles bot (lándzsa) már funkcióspecifikus információ. Szerintem a fehérje egy éles bot. Szerintetek lándzsa.
    Persze ez csak egy hasonlat, és emiatt több sebből is vérzik, de úgy látom ti ezt szeretitek.
    „A nukleinsavak olyan tulajdonsággal rendelkeznek, hogy kémiai szempontból a DNS bármely kombinációs mintája egyenértékű.” (Bernd-Olaf Küppers)” Bizonyára ez egy szövegkörnyezetből kiragadott mondat, mert bárki, aki dolgozott molekuláris biológiai laborban tudja, hogy ez nem így van. G és C között 3, A és T között csak 2 hidrogén-híd van, így egy GC gazdag régió felbontásához ( természetesen 2-szálú DNS-nél) nagyobb hőre van szükség, pl PCR reakciónál. Ez abszolút kémiai szempont. https://en.wikipedia.org/wiki/GC-content
    „Az, hogy a transzkripció során a polimeráz vagy a promóter hibákat ejt, nem új információs lánc létrejötte, hanem csak a meglévő módosulása (szinte mindig romlása).” Nana. Ha módosul az információ akkor az már nem új? Mire gondolsz? Ha egy fehérje X célpont helyett a mutáció miatt Y-t hasítja el akkor az nem új információ? Vagy ha a fehérje X szövet helyett a mutáció miatt Y szövetben fog kifejeződni az nem új információ? Hivatkozhatsz az információ-megmaradás törvényére, de akkor minden információ 13,8 milliárd éves, kár vitatkozni  Hívhatod információ-módosulásnak, de a funkciója más lesz és az a lényeg.
    „Na most egyetlen egyszerű – mondjuk 150 aminosavból álló – fehérje adott kombinációban való megépülésének valószínűsége kb. 10^195, ami nagyságrendekkel nagyobb szám, mint amennyi becsült elektron van az egész univerzumban! Az élet spontán keletkezése jól hangzik, amíg matematikusok nem néznek rá az esélyekre. A Wistar szimpóziumon aztán ezt megtették, és sokan nevetve fordultak el a neo-darwinista fikciótól. A darwinista E. O. Wilson pedig azt mondta, hogy inkább tartsuk távol a matematikát a biológiától.”
    Ezen tipikus evolúció-tagadó érv mellett már nem tudok elmenni, mert egyértelmű, hogy aki ilyet állít az nem ért a biológiához. A 10^195 azt jelöli, hogy ugyanaz a 150 aa fehérje mekkora valószínűséggel állna össze egy aminosavakkal teli kádban. Pl. A glifozát gyomirtó a növények EPSP szintáz génjét támadja. A szójába juttatva a bakteriális EPSPS-t az helyettesíteni tudja a növény saját génjének kiesett funkcióját. A 2 verzió közt az eltérés túl nagy a glifozátnak, de ugyanazt a funkciót látja el mindkét gén és a bakteriális verzió teljesen tudja helyettesíteni a növényit ebben a biokémiai útvonalban. A 2 gén szerepe, az általuk hordozott funkcióspecifikus információ ugyanaz. A 2 fehérje mégis csupán 34%-ban egyezik. Látható, hogy a fehérjék jelentős része nem hordoz funkcióspecifikus információt, igazából az a szerepük, hogy ne akadályozzák a fehérje többi részét a kémiai szerkezetükkel. A fehérjék funkcionális részei a domének: https://hu.wikipedia.org/wiki/Feh%C3%A9rjedom%C3%A9n . Ezek 5-20 aminosav hosszú szakaszok (több is lehet, de inkább nem), melyek megkötik a többi fehérjét, enzimatikus aktivitásuk van, DNS-t kötnek, átnyúlnak a lipidmembránon, stb. A doméneken belül fontosak egyes aminosavak, de nem mindegyik, van amelyik csak egy lehet a 20-ból, van amelyik több is lehet, csak a kémiai karaktere egyezzen, van amelyik bármi lehet, csak ne zavarja a többit. Ezt doménje válogatja, de elmondható hogy ez az 5-20 aminosav is változékony. De a köztük lévő többi aminosav még inkább. A valódi szelekció a doméneken van, a többi aminosavnál az a lényeg, hogy tartsa a struktúrát, ill ne tolódjon el a frame. Most biztos kiszámolod, hogy a 150 34%-a 51, és 20^51 az 10^34, ami szintén eszméletlenül nagy szám, bár elmondhatatlanul kisebb, mint a tiéd. Fontos, hogy a domének között szinte bármennyi aa állhat, sőt a doménen belül is van szabadság, amennyiben ellátja a funkciót. Így már kiszámolhatatlanul csökken ez a szám. A domének is sokfélék lehetnek. Az általam vizsgált enzimnek a katalitikus doménje csupán 2+4 aa-ból áll, melyből 1 aa szinte bármi lehet. A fehérjének van további 9 transzmembrán doménje (TMD), de a fehérje ezek nélkül is ellátja a fehérje emésztő funkcióját, a 9 TMD csak azért kell, hogy a belső membránba illessze. 37 aa-ból 6 látja el a katalitikus funkciót. Tudom, extrapoláció, de elképzelhető, hogy ez a 6 aminosav is elég lehetett, hisz pl baktériumokban nincs is belső membrán, ott jóval egyszerűbb is a gén ortológja. A TMD-k később is hozzáadódhattak, specializálva a funkciót. Maga ez a 2+4 aa szerkezet ráadásul több egyező funkciójú, de filogenetikailag független génben is jelen van, de a többi domén miatt kissé eltérnek, pl a lokalizációban. De az in vitro hatásuk ugyanaz. De ez az egész nem is csoda, hisz ez a 2+4 aa kialakulása nem nagy ügy még a matematikusok szerint se. Az se véletlen, hogy 1 domén mindig 1 exonon van és az új gének kialakulásának egyik módja az exon-shuffling, amikor új exon kombinációk alakulnak ki, így új domének kerülnek a fehérjére, ezzel plusz funkciókat adva neki. Pl egy 20 aa-ból álló peptid, mely tartalmazza a 2+4-et már mindjárt lehet transzmembrán, ha exon-shufflinggal kiegészül a TMD-t kódoló exonnal.
    „Arra mutass példát, hogy a vak természet új, funkcionálisan specifikus információt hozott létre! Ne extrapolált történetet mesélj arról, hogy a neo-darwinista modell szerint mi történt évmilliókkal ezelőtt, mert az pusztán feltételezés, hanem megfigyelt kísérletet mutass meg, ahol ez a szemünk előtt végbement. Mondjuk arra mutass egy példát, hogy egy kromoszóma nem elveszett, hanem keletkezett! (A neo-darwinizmus szerint ennél sokkal többre kellett képesnek lennie az evolúciónak, csak kell, hogy legyen most már példa arra, ennyi évtized intenzív vizsgálódás után, hogy egy jelentéktelen kis új kromoszóma természetes úton megépült… Persze ha így lenne, nem kellene Lenskinek még mindig azokkal a bacikkal vacakolnia a laboratóriumban, hogy valami áttörő eredmény végre mutatkozzon.)”
    Szégyellem, hogy növénybiológus létemre csak most jut eszembe, de: az általam vizsgált Medicago truncatula diploid, míg a termesztett, nagyobb terméshozamú rokona, a lucerna tetraploid. A búza 3 faj hibridje és hexaploid. A mag nélküli banán triploid. Az elsőt a természet hozta létre, a másik 2 nemesített, de ugyebár a nemesítés az irányított szelekció, egyik esetben se mutálták a genomot, csak kiválasztották a megfelelő egyedet és fenntartották. Ez bizony evolúció. A feleségem is biológus, stresszhatásra hoz létre diploid fűzből tetraploidot. Természetes szelekció a laborban. Csak hogy egyértelmű legyen: nem csak 1 kromoszóma jön létre a szemünk előtt, hanem genomok sokszorozódnak meg. A szója tetraploid genomja, ami természetesen jött létre, annyi mutációt halmozott fel, hogy az egyik diploid genomjának a megfelelő kromoszómái nem homológok a másik diploid genom megfelelő kromoszómáival, külön evolválódnak (mikroevolválódnak, a kedvetekért).

  • Szabados Ádám says:

    Lima Rui,

    dőlt betűvel szedtem a te mondataidat, amelyekre reagálok.

    Habár megint erről írsz, de én meg sem próbáltam a DNS kód keletkezéséről írni. Nyilvánvalóan erről még nem tudunk eleget és amit tudunk, az neked nem elég. Én arra próbáltam rávilágítani, hogy a hasonlataitok a nyelvvel és egyéb kódokkal mennyire nem áll közel a DNS-kódhoz.

    Szerintem félreérted az információs kód természetét. Az információ lényegét tekintve nem változik attól, hogy milyen hordozón jelenik meg. Ezt hangsúlyozta dzsaszper is korábban: ugyanaz az információ különböző kódnyelvre átírva, akár különböző eszközökön is megjelenhet. A nukleotidok sorrendje az információ, ez az információ megjelenhet más hordozón, más kódnyelvre írva is (kézenfekvő példa az mRNS), de (tudomásunk szerint) csak a fehérjék szintézisében funkcionálisan specifikus.

    Hogy a DNS-kód keletkezéséről tudhatunk-e valamit, és ha igen, mit? Természettudományos eszközökkel lényegében semmit nem tudunk a kód eredetéről, megmosolyogtató tudományos-fantasztikus spekulációk vannak csak (pl. RNS-világ hipotézis, Gánti autokatalitikus kemoton-modellje). Engem ez a kudarc teistaként és keresztényként egyáltalán nem lep meg. Egy gondolatkísérletet engedj meg. Tegyük fel egy pillanatra, hogy az univerzum és benne az élet tényleg Isten Szavára keletkezett, ahogy teisták (vagy legalábbis zsidók és keresztények) gondolják. Vagyis intelligens ok áll az élővilágot irányító információ mögött, ahogy azt máskor is tapasztaljuk a jelenségek világában. (Nem kell, hogy higgy a Teremtőben, csak a gondolatkísérlethez kérlek, hogy fogadd el kiindulópontnak.) Ha így történt (tegyük fel egy pillanatra, hogy igen), akkor irányítatlan anyagi folyamatok ugyanúgy nem fogják tudni soha megmagyarázni ennek az információnak az eredetét, ahogy a számítógépes szoftver informatikai kódjának eredetét sem fogjuk tudni soha felfedezni, ha az informatikust kizárjuk az okok közül. (Irányítatlan anyagi folyamatok a szoftver eredetét sem tudják megmagyarázni.)

    Ha Isten Szava hozta létre az első élőlényeket (a bennük lévő genetikai és epigenetikai kódokkal), ahogy az informatikus elméje a szoftver kódját, akkor az élet létrejöttét azért nem tudjuk irányítatlan anyagi folyamatok által megmagyarázni, mert nem azok által jött létre. Naturalista világnézetben ez persze elfogadhatatlan feltevés, mert a naturalista filozófia eleve kizárja a Teremtőt a lehetséges magyarázatok közül. A teista világnézetben viszont ez a lehető leglogikusabb és legésszerűbb feltevés. Zárójelben jegyezzük meg, mert fontos: a naturalizmus nem a tudományból következik, hanem attól független metafizikai alapállás. Ahogy Paul Davies, Robert Oppenheimer és A. N. Whitehead (és sokan mások) hangsúlyozták: a modern tudomány a monoteista világnézetből nőtt ki. A teista nem akar mindenáron anyagi okokat keresni ott, ahol elképzelhető, hogy nem anyagi okok játszottak szerepet (mint amilyen az intelligencia, aminek a kreatív megnyilvánulásait nap mint nap tapasztaljuk).

    Azt próbáltam az előzőekben kifejteni, hogy habár a sorrend tetszőleges, a funkció amit kódol létszükséglet, hogy megfelelően működjön, így a kód maga, ami az élőlényekben van nem tetszőleges (persze sok helyen az, ez lenne a junk DNS vagy egyéb nem fontos szakaszok). Potenciálisan a sorrend tetszőleges, de ebből egy olyan kombináció valósul meg, mely az adott életképes élőlényt adja ki. Illetve milliónyi, milliárdnyi kombináció, ahány faj illetve egyed van.

    Nem egészen értem, miért hangsúlyozod ezt, hiszen én is éppen ezt mondom. Ez a DNS-ben lévő információ funkcionális specifikussága.

    „A nukleotidok sorrendjét viszont nem kémiai kapcsolat határozza meg, hanem valami más. „ Ez a más az én olvasatomban a természetes szelekció, amit lényegében az előzőekben fejtettem ki.

    Természetes szelekcióról csak akkor beszélhetünk, amikor már van replikátor (DNS, és a sejt, aminek a DNS „belső szerve”). A természetes szelekció tehát az élet eredetének magyarázataként nem jöhet szóba, ebben biztosan egyetértünk. Hogy az első életből a természetes szelekció által kialakulhatott-e a ma ismert biológiai változatosság, az komoly vita tárgya. A véletlen mutáció és a természetes szelekció a megfigyeléseinkben és a kísérleti tapasztalatainkban nem hoz létre új, funkcionális szekvenciákat, legfeljebb módosítja (a mutáció szinte mindig károsan) a meglévőket, illetve megkettőzi vagy kivágja a már létező információt. Nem elég – és tudományos szempontból teljesen elégtelen – pusztán állítani, hogy a természetes szelekció képes az egyik fajból a másik fajba, egyik rendből a másik rendbe, egyik törzsből a másik törzsbe való átmenetet biztosítani. Pontosan ez az, amivel kapcsolatban nem akarnak szűnni, sőt, egyre mélyebbek a kételyek, olyannyira, hogy a Brit Királyi Társaság (a Brit Tudományos Akadémiával együtt) éppen novemberben rendezi azt a tudományos konferenciát, amely a neo-darwinizmus elégtelenségét látva új szintézis létrehozását szorgalmazza.

    Tehát nekem természetesen nem válasz az, hogy „a természetes szelekció csinálta”. Ez tudományos szempontból komolytalan. Épp most fejeztem be Joachim Bauer Az együttműködő ember c. könyvét, amelyben az ismert molekuláris biológus kijelenti: „azt, hogy az egyszerű biológiai rendszerekből hogyan tudtak kifejlődni a magasabb (komplexebb) rendszerek, élőlények… nem lehet megválaszolni Darwin variáció- és szelekcióelveivel” (103). Ezt ma nagyon sokan gondolják így, és az ok egyértelmű: nincs bizonyíték arra, hogy a feltételezett mechanizmus képes lenne rá, sok okunk van viszont arra, hogy ebben kételkedjünk.

    A nyelveknél a szavak és jelentésük között nincs más kapcsolat, csak az emberi asszociáció. A DNS kód és a fehérjék között egyértelmű kémiai kapocs van. (…)Az operációs rendszereknél már direktebb a kapcsolat, de ott az ember rendeli a funkciót a kódhoz, a logikai kapukkal, különböző parancssorokkal. (…)Továbbá az op rendszerekre csupán mesterséges szelekció hat, és ilyen egy biológiai lénynél, még a kutyáknál sincs. Ezért rosszak a hasonlataitok. Sőt, ha ezekből a hasonlatotokból indultok ki és ezért kerestek intelligenciát a DNS kód mögött, akkor tévútra kerültök.

    Ami magát az információt illeti, nincs különbség a nyelvi kód, az informatikai kód és a DNS kémiai nyelvű kódja között. Ami az információ megjelenítését (megtestesülését, materializálódását) illeti, ott valóban van különbség, hiszen az emberi nyelv kódjait a hangok (hanghullámok) illetve a betűk (tintával, grafittal vagy elektronikus bitek segítségével, papírra, pergamenre, kőtáblára, viaszra, pixelekkel stb. írva) hordozzák, a számítógépes kódot elektromos jelek jelenítik meg, különböző adathordozókra mentve, illetve a hardver elektronikus rendszerét aktiválva – sokszor bonyolult, fizikailag is észlelhető cselekménysort indukálva –, a DNS kódját viszont kémiai molekulák (nukleotidok) hordozzák. A különbség az információ hordozójában és az információ funkcionális specifikusságában van.

    Abban is van különbség, hogy milyen irányítatlan anyagi folyamatok okozhatnak változást a kódban. A tintával papírra írt szöveg esetében a víz például elmoshatja a szöveg egy részét, vagy akár az egészét is, a kőbe vésett szöveget az erózió olvashatatlanná teheti, a számítógépes kód funkcionalitását programok egymásba akadása teheti tönkre, de fizikai erővel is megsemmisíthető az információ (pl. kalapáccsal összetöröm a hordozót). A DNS esetében az információ módosulását NEM a természetes szelekció hajtja végre, hanem a másolás során keletkezett véletlenszerű hibák. A szelekció csak olyan allélek közül válogathat, amelyek már (véletlenül) létrejöttek. Az információ létrejöttének matematikai valószínűségét tehát ugyanúgy vizsgálhatjuk és mérhetjük, mint a többi esetben. A fenti cikk pedig éppen egy ilyen matematikai teszt eredményét mutatja a hominida populációk kapcsán.

    Szerintem a fehérje egy éles bot. Szerintetek lándzsa.

    Most cseréljük ki az analógiát egy olyan példára, ami a specifikált információ mennyiségét tekintve jobban korrelál a fehérje komplexitásával. Mondjuk legyen egy HILTI ütvefúró. Szerinted a fehérje egy nehéz vasdarab. Szerintünk a fehérje egy HILTI ütvefúró.

    „A nukleinsavak olyan tulajdonsággal rendelkeznek, hogy kémiai szempontból a DNS bármely kombinációs mintája egyenértékű.” (Bernd-Olaf Küppers)” Bizonyára ez egy szövegkörnyezetből kiragadott mondat, mert bárki, aki dolgozott molekuláris biológiai laborban tudja, hogy ez nem így van. G és C között 3, A és T között csak 2 hidrogén-híd van, így egy GC gazdag régió felbontásához ( természetesen 2-szálú DNS-nél) nagyobb hőre van szükség, pl PCR reakciónál. Ez abszolút kémiai szempont.

    Persze, hogy az, csak ez irreleváns, hiszen én az egymás melletti bázisokról beszéltem, nem az egymással szembeni bázisokról. Az egymással szembeni bázisok mindig a bázispárjukkal hoznak létre hidrogén-kötéseket (pont úgy, ahogy mondod: a guanin és a citozin között hármas, az adenin és a timin között kettes hidrogén-kötés). Ez azonban nem határozza meg azt, hogy egymás mellett milyen bázispárok legyenek, hiszen ha ez meghatározná, nem beszélhetnénk DNS-ről. Akkor mindig ugyanazok a bázispárok ismétlődnének, az információ redundánssá válna, a DNS elveszítené információhordozó képességét. A valóság persze az, hogy akármilyen bázispárok lehetnek akármilyen bázispárok mellett, ezért különbözőek a DNS-láncok. Az egymás mellett elhelyezkedő A, G, T, C bázisok között nincsen közvetlen kémiai kötés, hiszen a bázisok a cukorhoz kapcsolódnak, a cukor pedig a foszfáton keresztül áll össze lánccá.

    „Az, hogy a transzkripció során a polimeráz vagy a promóter hibákat ejt, nem új információs lánc létrejötte, hanem csak a meglévő módosulása (szinte mindig romlása).” Nana. Ha módosul az információ akkor az már nem új? Mire gondolsz?

    Az információ módosulása nem feltétlenül új információ. Ha valaki véletlenszerűen belepiszkál egy Word-ben írt szövegembe (mondjuk ebbe itt), az módosíthatja a szöveget, meg is kettőzheti, sőt, törölheti is, de nem új információt fog ezzel létrehozni (hacsak nem tudatosan változtat rajta), hanem a régit teszi tönkre vagy kettőzi meg. Előfordulhat, hogy mondjuk a „lehetetlen” szóból véletlenül kitörlődik az „l” és „ehetetlen” lesz belőle, vagy a „ma” szó véletlen megkettőzéséből „mama” lesz. Még az is megtörténhet, hogy a mondat ettől értelmes marad, sőt, akár más szemantikai szerepet tölt be. Ilyenre irányítatlan anyagi folyamatok is képesek. Ezzel a módszerrel azonban új szöveg nem fog íródni, legalábbis nem a probabilitási határokon belül.

    Peter Medawar orvosi Nobel-díjas biológus mondta: „A logikai érvelés semmilyen folyamata – semmilyen elme vagy számítógépre programozható algoritmus – nem növeli azoknak az axiómáknak, posztulátumoknak vagy tapasztalati állításoknak az információtartalmát, amelyekből kiindul.” Ezt megerősíti L. Brillouin is az információelméletről szóló könyvében: „Egy gép nem hoz létre új információt, de a már ismert információt igen hatékonyan képes átalakítani.” A gép szót behelyettesíthetjük bármilyen mechanisztikus anyagi folyamatra. (Gödel – a 20. század egyik legnagyobb matematikusa – éppen emiatt gondolta, hogy a darwini evolúcióelmélet szinte biztosan nem lehet igaz.)

    Arról nem is beszélve, hogy ahogy a fenti cikkben hangsúlyoztam, a „várakozási idő” nagyon komoly probléma, hiszen az előnyös és „értelmes” mutációnak meg kell születnie (legyen az pontmutáció, inszerció, deléció), utána meg kell kapaszkodnia a populációban, majd fixálódnia kell, és ennek megszámlálhatatlanul sok esetben végbe kell mennie, úgy, hogy a genetikai sodródás ne veszítse el a fehér hollónál is ritkább előnyös mutációt, a mutációk ne oltsák ki egymást, és ne történjen re-mutálódás sem. Természetesen van mutáció általi változékonyság, de a darwini evolúció előtt álló feladatokhoz ez körülbelül annyira kevés, mint a Csomolungma megmászásához az, hogy valaki fel tud menni a Nyúl-dombra.

    A doméneken belül fontosak egyes aminosavak, de nem mindegyik, van amelyik csak egy lehet a 20-ból, van amelyik több is lehet, csak a kémiai karaktere egyezzen, van amelyik bármi lehet, csak ne zavarja a többit. Ezt doménje válogatja, de elmondható hogy ez az 5-20 aminosav is változékony. De a köztük lévő többi aminosav még inkább. A valódi szelekció a doméneken van, a többi aminosavnál az a lényeg, hogy tartsa a struktúrát, ill ne tolódjon el a frame. Most biztos kiszámolod, hogy a 150 34%-a 51, és 20^51 az 10^34, ami szintén eszméletlenül nagy szám, bár elmondhatatlanul kisebb, mint a tiéd. Fontos, hogy a domének között szinte bármennyi aa állhat, sőt a doménen belül is van szabadság, amennyiben ellátja a funkciót. Így már kiszámolhatatlanul csökken ez a szám.

    Továbbra is állati nagy számokról beszélünk.

    Szégyellem, hogy növénybiológus létemre csak most jut eszembe, de: az általam vizsgált Medicago truncatula diploid, míg a termesztett, nagyobb terméshozamú rokona, a lucerna tetraploid. A búza 3 faj hibridje és hexaploid. A mag nélküli banán triploid. Az elsőt a természet hozta létre, a másik 2 nemesített, de ugyebár a nemesítés az irányított szelekció, egyik esetben se mutálták a genomot, csak kiválasztották a megfelelő egyedet és fenntartották. Ez bizony evolúció. A feleségem is biológus, stresszhatásra hoz létre diploid fűzből tetraploidot. Természetes szelekció a laborban. Csak hogy egyértelmű legyen: nem csak 1 kromoszóma jön létre a szemünk előtt, hanem genomok sokszorozódnak meg.

    A megsokszorozódás nem új információ, hanem a meglévő információ másolódása. A természet és a mechanikus folyamatok minden további nélkül képesek rá. De erről már korábban is beszéltünk (biológus kollégád, Veszt is utalt rá).

  • dzsaszper says:

    Kedves Lima Rui és Ádám,

    1. @Lima Rui: Minél többet mesélsz a genom működéséről, annál inkább megerősítesz abban, hogy a DNS egy programozási nyelv 🙂 Külön köszönet a domének említéséért.

    2. @Ádám: épp ezért az ütvefúrót sokkal egyszerűbbnek tartom, mint a génbiológiát. A célra tartó rakéta korrektebb hasonlat lenne szerintem, beépített számítógéppel és szoftverrel 🙂

    A nyelveknél a szavak és jelentésük között nincs más kapcsolat, csak az emberi asszociáció.
    Ezek szerint az is csak emberi asszociáció, hogy az expresszvonat vezetője kiadja a fékezési parancsot, a vezérlés pedig behúzza a féket… Hisz a vezérlő szoftver forráskódja szavainak jelentése nem más, mint puszta emberi asszociáció.
    A helyedben nem ülnék expresszvonatra többet… 😉

    Ami pedig a hegységképződést illeti, legalább egy valamire való vulkánkitörést illene látni…

  • Szabados Ádám says:

    Először Boeing 747-est írtam, aztán arra gondoltam, az ütvefúró is megteszi.

  • Lima Rui says:

    „Minél többet mesélsz a genom működéséről, annál inkább megerősítesz abban, hogy a DNS egy programozási nyelv Külön köszönet a domének említéséért.”
    Szívesen. Az atomok szerkezete is programozási nyelv? +-: hidrogén. +0-: deutérium. Oxigén 3 izotópja: ++++++++——–, ++++++++0——–, ++++++++00——–. Víz: +-+-++++++++——–. Ez nem mond semmit a halmazállapotról. De hát a DNS kód se mond semmit az aminosavak viselkedéséről az eltérő pH-kon.
    A elején tegyünk helyre pár dolgot:
    „„Egy gép nem hoz létre új információt, de a már ismert információt igen hatékonyan képes átalakítani.” A gép szót behelyettesíthetjük bármilyen mechanisztikus anyagi folyamatra.”
    Egy csillagban sem jön létre új információ a fúzió során? Az össze héliumnál nehezebb elemre gondolok. A molekulák és vegyületek is olyan tulajdonságokkal rendelkeznek, amivel az alkotó atomok nem bírnak. Ez nem új információ?
    „„A nukleinsavak olyan tulajdonsággal rendelkeznek, hogy kémiai szempontból a DNS bármely kombinációs mintája egyenértékű.” (Bernd-Olaf Küppers)” Bizonyára ez egy szövegkörnyezetből kiragadott mondat, mert bárki, aki dolgozott molekuláris biológiai laborban tudja, hogy ez nem így van. G és C között 3, A és T között csak 2 hidrogén-híd van, így egy GC gazdag régió felbontásához ( természetesen 2-szálú DNS-nél) nagyobb hőre van szükség, pl PCR reakciónál. Ez abszolút kémiai szempont. Persze, hogy az, csak ez irreleváns, hiszen én az egymás melletti bázisokról beszéltem, nem az egymással szembeni bázisokról.„
    Én is. Már bocsánat, Ádám, de ilyenkor válik nyilvánvalóvá, hogy az ismereteid hiányosak a témában. Tudom, ezt nem is tagadod, ezért faramuci az egész beszélgetés. Egy szakmabeli győzköd arról, hogy ő jobban átlátja a saját szakmáját, mint te, a laikus. Lehet, hogy arrogánsan hangzik, de én is vízvezeték szerelőt hívok, ha elromlik a csap, nem én javítom meg, hiába van diplomám, azzal max felitatom az ömlő vizet. A GC gazdag régióban sok G és C áll egymás mellett, így a stabil, kétszálú DNS konformáció révén velük szemben is sok C és G áll, hármas kötéssel. Egy ilyen szakasz felnyitásához jóval több energiára van szükség, ahogy a gyakorlat is mutatja. Azaz kémiailag nem egyenértékű GGGCAGCTAC a AATGCTGATA-val, hisz az előbbinek 70%-a GC, addig az utóbbinak csupán 30%-a, így az első esetben a kettős szál felbontásához jóval több E kell.
    És a kettős szál magától összeáll, ne felejtsük el, a bázispárosodás rövid szakaszok esetén színtiszta kémiai replikáció útján is végbemegy. AAA magához köt 3 T-t, majd szétválva (pl hő hatására), újabb 3 T illeszkedik egymás mellé AAA-val szemben, míg a TTT-vel szemben 3 A áll össze. Stb.
    „Szerintem a fehérje egy éles bot. Szerintetek lándzsa.
    Most cseréljük ki az analógiát egy olyan példára, ami a specifikált információ mennyiségét tekintve jobban korrelál a fehérje komplexitásával. Mondjuk legyen egy HILTI ütvefúró. Szerinted a fehérje egy nehéz vasdarab. Szerintünk a fehérje egy HILTI ütvefúró.„
    És tévedtek. A vasdarabban a vas atomokat kémiai kötések kötik össze és a környezettel összhangban alakítják ki a szerkezetet. A HILTI ütvefúrónál egy gomb lenyomásával aktiválsz elektródákat, hogy azok aktiváljanak egy fúrófejet. És itt jön a lényeg: a fúrófejet az ember alakítja ki, hogy fúrjon egy lyukat oda, ahová az ember teszi, akkor amikor az ember lenyomja a gombot. A fúrófej atomjai stabil szerkezetben állnak és mechanikusan roncsolják szét a célfelületet. A fehérjék nem így működnek. Azoknak az egyik sarkában szabad elektronok gyűlnek fel, vagy épp elektron-hiány, mely elvonja a szubsztrát elektronjait, így katalizál reakciót. Színtiszta kémiai. A fúrófej bármit kifúr, ami nem keményebb nála, elég ha az ember odateszi. A fehérjék fizikai-kémiai úton közelítik meg egymást, lépnek interakcióba és teszik azt, amit a szerkezetük enged. A fúrófej gyakorlatilag egy nehéz vasdarab, melyet elektronika hajt, amit egy gombbal aktiválsz. Igazából nem több. Szétfúr az bármit. A következőkben szintén ezt fejtem ki:
    A lényeg:
    „Ezek szerint az is csak emberi asszociáció, hogy az expresszvonat vezetője kiadja a fékezési parancsot, a vezérlés pedig behúzza a féket… Hisz a vezérlő szoftver forráskódja szavainak jelentése nem más, mint puszta emberi asszociáció.”
    A vezető meghúzhat egy kart, mely mechanikusan vagy megnyomhat egy gombot, ami elektronikusan aktiválja a féket. Ugyanilyen kar kinyithat vagy bezárhat egy ajtót vagy a gomb benyomása kilőhet egy rakétát vagy megjeleníthet a képernyőn „H” vagy „L” betűt is. Nincs összefüggés a kód és a funkció között, csak az emberi elme és amit kitalál. Így értettem az asszociációt, hogy az információt és az azt hordozó kódot az ember rendeli hozzá a fizikai funkcióhoz. A biológiában ez fizikai-kémiai szükségszerűség. 1) A fehérjének van funkciója, melyet az aminosav sorrend és az aminosavak tulajdonságai (és egyéb kémiai módosítások) határoznak meg. 2) Az aminosavakat a tRNS rendeli a nukleotid kódhoz, kémiai úton. Ha a tRNS mutálódik akkor ugyanaz a kód mást fog jelenteni, ahogy pl a Candidánál a CUG kodon. 3) Kód=DNS=RNS=fehérje=funkció. Minden egyenlőségjel egyben szoros kémiai kapcsolat is. Visszatérve a fékre: a DNS kódja olyan, mintha egyféle kar (kód) csak egyféle fogaskereken (tRNS) keresztül tudna kapcsolódni a fékhez (fehérjefunkció). A kulcs a tRNS, melynek a kémiai szerkezete viszi át a kódot a DNS/RNS-ről az aminosavra. Valójában az egésznek a lényege a fehérje, annak a tulajdonságai határozzák meg a funkciót. A DNS csupán ennek interpretálása. A DNS a fehérjében rejlő kód lebutítása egy stabil, jól öröklődő formába. Mindig is vonzott a genetika, tényleg imádom, de minél jobban értek hozzá, minél nagyobb a tapasztalatom, annál inkább látom, hogy a biokémia, a fehérjék a lényeg. A DNS kód (a fehérjekódoló rész) tripletei csupán az aminosavak leegyszerűsített, öröklődő reprezentánsa. A DNS jelöli az aminosavak sorrendjét, de ezen felül az aminosavaknak vannak tulajdonságai is, melyek meghatározzák a belőle felépülő fehérje funkcióját. A DNS-nek ezeket a tulajdonságokat nem kell kódolnia, a lényeg, hogy a tRNS a megfelelő aminosavat rendelje a kódhoz, a többit, a funkciót, megteszi a kémia. Ezért születetett meg az RNS-világ elmélet, illetve feltételeznek fehérje-világot, prionszerű replikátorokkal, önsokszorozó vagy önmásoló fehérjékkel. A lényeg a funkció, melyet hordozhat fehérje vagy ribozim vagy akár egy fém-kelát/ion. A DNS csupán ennek reprezentációja, mely könnyen öröklődik. A DNS-t a funkcióval a tRNS köti össze.
    Visszatérve a fékre. Arra akartam rávilágítani (immár negyedszer), hogy míg a PIN-kód, nyelv és op rendszerek esetén az ember köti össze a tetszőleges kódot és hordozót az általa választott funkcióval, addig a biológiai kód kémiailag determinált. A funkciót a fehérje hordozza, melyet a kémiai karaktere határoz meg. A DNS kód határozza meg a fehérje alkotóelemeit, melyek kémiai karaktere adja a fehérje funkcióját. Ezek elválaszthatatlanok egymástól.
    Beszélek kicsit a munkámról, illetve hogy merre halad.
    Sok fehérje első 20-30 aminosava valójában egy levágódó szignál peptid (SP), melynek a feladata, hogy a fehérje a megfelelő helyre jusson. Valójában az SP egy erősen hidrofób fehérjeszakasz, mely kémiai tulajdonságai miatt épül be a membránba: a citoplazma membránba a prokariótáknál, az endoplazmatikus retikulumba az eukariótáknál. Ha nem elég hidrofób akkor már a citoplazmában transzlálódik a teljes fehérje, míg ha elég hidrofób, akkor a membránban, és ez pecsételi meg a további sorsát. Hogy elég hidrofób e, azt egy fehérje dönti el, az SRP: a kötődésével vagy annak hiányával választja ki a fehérje sorsát, így lesz a fehérjéből citoplazmás vagy a membránokon keresztül a vezikula transzport másra szánja, esetleg a mitokondriumba/kloroplaztiszba/szimbioszómába megy e. Viszont mivel a fő funkciója a központi hidrofób domén (és ennyi, a többit a kémia megoldja), ezért az ezen kívül eső részekre minimális szelekció hat, így új szekvenciák jelennek meg, melyek a kémiai tulajdonságuk alapján új funkciót adnak az SP-nek. Az is számít ha az N-terminális szakasz megnyúlik, így az SP elérhet akár 100 aaminosavat is. Így jóval lassabban hasítódik le az SP, illetve a szerkezete nem enged oda módosító enzimeket (pl glikoziláció).
    Úgy érzem Ádámot félrevezeti az információelmélet, legalábbis a biológiában. „A megsokszorozódás nem új információ, hanem a meglévő információ másolódása.” Több génről több géntermék, fehérje keletkezik, ez eltolja a fenotípust. A fehér bőrből barna lesz, mely jobban elnyeli az UV sugarakat, így kevesebb D3 vitamin keletkezik. Vagy egy több fehérjéből álló komplex arányai módosulnak az egyik komponens túlsúlya miatt, így az aktív fehérjekomplex más lesz, más funkcióval. Egy transzkripciós faktor ha duplikálódik akkor akár gének százainak is duplikálhatja az expresszióját, mely száznyi útvonalba avatkozhat bele.
    Valójában amellett érvelek, hogy a rendszer nagyságrendekkel bonyolultabb, mint ahogy ti hiszitek. Ti amellett érveltek, hogy a rendszer túl bonyolult ahhoz, hogy magától létrejöjjön.  
    Az a gond, hogy túl antropocentrikusak vagytok. Az emberi intelligencia alkotásaihoz (nyelv, op rendszer, PIN kód) méritek a biológia rendszerét, pedig nem összehasonlíthatóak, hisz a biológia kémiai törvényszerűségekből, kényszerekből levezethető. A biológiában az ATG az metionin, mely hidrofób, kén tartalmú vegyület. A kódnak fizikai valója van. Nem számít, hogy a PIN kódban a 2-es szám, hogy görbül, viszont az aminosavak formája pont a lényeg, akárcsak a sorrend, amit ténylegesen meghatároz a kód. Az aminosav tulajdonságait viszont nem határozza meg a kód. A tRNS interpretálja a kódot és alakítja fizikai valósággá, aminosavvá, mely valóságos karakterrel bír. De attól még a DNS és az aminosav ugyanaz az információ, csak más nyelvben. De az aminosav révén ez a nyelv a valóság része.

  • Szabados Ádám says:

    Kedves Lima Rui,

    amikor a kód specifikált információját visszafelé, a kód működésének kémiájával (a hardver kattogásával) magyarázod, egyrészt azt demonstrálod, hogy nem érted a problémát, másrészt rengeteg (itt) irreleváns technikai részlettel ködfelhőt fújsz magad köré, amivel eltakarod az alapvető tényt, hogy továbbra sem a DNS-kód információjáról, hanem annak működéséről beszélsz. Ezt a hibát még az ateista Paul Davies sem követi el, pedig ő is természetes magyarázatot keres a DNS specifikált információjára (l. Az ötödik csoda 2. és 4. fejezet).

    „Ahogy a floppylemez, maga a DNS is hardver, döntő jellemzője azonban nem az anyag, amiből a DNS felépül, hanem a bázispárjaiba írt üzenet. Helyezzük ezt az üzenetet a megfelelő molekuláris környezetbe – a megfelelő szemantikai kontextusba -, és lám, máris világra jön az élet! Az élet tehát a hardver és a szoftver szerencsés keveréke. Több puszta komplexitásnál: informált vagy instruált komplexitás.” (Davies, 111)

    A DNS-kód szekvenciájának információhordozó képessége a kontingenciától függ. „A biológiailag releváns makromolekulák egyidejűleg rendelkeznek két létfontosságú tulajdonsággal: véletlenszerűséggel és rendkívüli specifikussággal.” (Davies) Te valamiért ragaszkodsz ahhoz, hogy ez a sorrend kémiailag determinált, de ehhez visszafelé érvelsz: azt mutatod meg, hogy a bázisok hidrogénkötéssel kapcsolódnak a bázispárjukhoz, majd azt mondod el (néhány ad hominemmel tűzdelve), hogy az egyik bázissorrend nem egyenértékű a másik bázissorrenddel, hiszen az egyik felbontásához több energiára van szükség, mint a másik felbontásához (más, amiben C és G képez H-hidat, más, amiben A és T).

    Csakhogy ezzel a lényeg felett siklasz át: mindenféle bázissorrend létezik, mert a dezoxiribonukleinsav természete olyan, hogy akár citozin, akár guanin, akár adenin, akár timin állhat bármelyik cukorfoszfát molekulán, és tetszőleges sorrendben állhat bármilyen bázispár bármilyen bázispár mellett (ez a valóság). Ez a kontingencia vagy véletlenszerűség pedig létfontosságú. A purin és pirimidin bázisok mindig ellentétjüket vonzzák magukhoz, ezért lesznek az egyik helyen kettős, a másik helyen hármas kötések, különböző energiaigényű kémiai kapcsolatot létrehozva. Az egymással szemben álló bázisok (A-T, C-G) egymással való kapcsolatának determináltsága miatt lehet felépíteni egyetlen fonálból annak inverzét, és így magát a kettős hélixet. Ennek azonban ugyanúgy semmi köze ahhoz, hogy miért olyan a fonál információs kódja, amilyen, mint ahogy az előhívott fénykép negatívja sem magyarázza az eredeti fényképet. A bázispárok közötti (A-T, C-G) determinált kötések nem határozzák meg, hogy mely pár mellett mely pár álljon (milyen bázisszekvencia legyen), mert az viszont nem determinált. Ha determinált lenne, megszűnne a DNS egyik létfontosságú tulajdonsága: a kontingencia.

    Az ad hominemre is hadd térjek ki egy pillanatra. Azok az érvek, amelyeket a tiéddel szembeállítok, nem a saját érveim, hanem olyan biokémikusok és molekuláris biológusok érvei, akiknek ez a szakterülete. Róluk – jogosan vagy nem jogosan – azt feltételezem, hogy talán nálad is többet tudnak erről a területről. Ez persze lehet, hogy nem így van, de amikor az érveidet olvasom, nem azt tapasztalom, hogy megcáfolnád az ő érveiket, amelyek engem meggyőznek, hanem azt, hogy mellébeszélsz. Lehet, hogy bennem van a hiba, nem jól adom át azt, amit látok, de hidd el, veled kapcsolatban nem azt élem át, hogy jobb érvekkel lesöpröd az asztalról az általam nagyra becsült szakemberek érveit, hanem azt, hogy egyáltalán nem az érveikre válaszolsz, hanem folyamatosan másról beszélsz.

    Egyre inkább az a benyomásom, hogy bár biológus vagy, és nyilvánvalóan sokat tudsz a génekről, többet, mint én, nem érted, miért információ a DNS kódja, és azt sem, mi az információ, és mi a specifikált információ. A sok fától mintha nem látnád az erdőt. Pedig az információ megértése a kulcs ahhoz, hogy megértsd a probléma nagyságát, amivel mindazok szembenéznek, akik az élet és a biokomplexitás eredetét irányítatlan fizikai-kémiai folyamatok révén akarják megmagyarázni. Wigner Jenő megértette a probléma mibenlétét és nagyságát. Richard Smalley is megértette. Polányi Mihály is megértette. Ernst Chain is megértette. Dean Kenyon is megértette. David Berlinski is megértette. Antony Flew is megértette. Paul Davies is megértette. A listát hosszan folytathatnám. Te viszont mintha nem értenéd.

  • Szabados Ádám says:

    Lima Rui,

    mielőtt válaszolsz, hadd illusztráljam kettőnk vitáját a CNC esztergagéppel. Az esztergagép számítógépes vezérléssel működő forgácsológép, amely forgótestek megmunkálásával alkatrészeket gyárt. Az esztergagép olyan elemekből áll, mint a főhajtómű, a gépágy, a szerszámváltó, a golyósorsó, a lineáris motor, a szerszámtároló stb. A vezérlést számítógépes szoftver végzi, amelynek értékeit a célnak megfelelően be lehet állítani.

    Ha ezt használjuk analógiaként, akkor a DNS kódja felel meg a szoftvernek. Ez persze ugyanúgy fizikai információhordozón (nukleotidok) jelenik meg, ahogy a CNC szoftverkódja (lemez, CD, USB, közvetlen számítógépről vagy hálózatról történő betöltés stb.), de az információhordozó és az információ nem azonos, hiszen az információt akár más hordozó is megjelentetheti (a DNS esetében pl. az mRNS inverz kódja az uracillal, de ad abszurdum az A, T, C, G nyelvi kódok is ugyanannak az információnak a hordozói, csak nem funkcióspecifikus környezetben).

    Honnan van a CNC szoftverében tárolt funkcióspecifikus információ? (Ez lényegében ugyanaz a kérdés, csak más kontextusban, mint az, hogy honnan van a DNS nukleotid bázissorrendjében tárolt funkcióspecifikus információ.) Honnan van az az információ, amely az egyik esetben konkrét alkatrészeket dob ki (pl. orvosi műszer fémorsóit), a másik esetben az élet működéséhez szükséges, konkrét összetételű és geometriai alakzatú fehérjéket (pl. hemoglobint, kollagént vagy kazeint)? Mindkét esetben fontos kérdés, hogy honnan van maga az információ.

    Te úgy válaszoltad meg a kérdést, hogy hosszasan elmesélted, hogyan kapcsolódik a bázis a párjához, hogyan működik a fehérjeszintézis, hogyan lesznek az aminosavakból fehérjék, hogyan működnek a fehérjék stb. stb. Ez pont olyan, mintha a CNC vezérlését a CNC programkód leolvasásával, majd annak hatására a forgácsológép hardverének működésében előállt folyamatokkal magyaráznád, és ezt hosszasan, rengeteg technikai részlettel mondanád el. A CNC kódját a CNC kódvezérelt működésével magyarázni azonban értelmetlen gondolatmenet, vagyis nonszensz. Ugyanígy nonszensz a DNS-kód kémiai nyelven írt információját a DNS-kód biokémiai működésével magyarázni. (Az okot ugyanis nem lehet az okozattal magyarázni.)

    Sőt, a „hardver” hangsúlyozása valójában rámutat még egy nehézségre, amivel a naturalista magyarázatoknak szembe kell nézniük. Többször utaltam rá (most a legutóbbi hozzászólásodban te is), hogy az információ, aminek az eredetére magyarázat kellene, nem csak a DNS bázisszekvenciái által kódolt információ, hanem a sejtben máshol tárolt, epigenetikai információ is. Ahogy Denis Noble – a rendszerbiológia egyik atyja – hangsúlyozza, a sejt használja a DNS kódot, nem fordítva. Az, hogy a DNS kódja hogyan lép működésbe, nem a DNS kódja által vezérelt. A DNS kódja azt határozza meg, hogy a kód leolvasása milyen végeredményt fog kidobni, azt nem, hogy ezt hogyan végzi el a sejt. A sejt azonban szintén információ-vezérelt, sokkal bonyolultabb fizikai rendszer, mint a szintén rendkívül intelligensen megtervezett CNC-hardver. Az a kérdés is előttünk áll tehát, hogy honnan van az az információ, amely a sejtet a DNS-kód leolvasására és használatára alkalmassá teszi.

    A CNC működése nem magyarázza meg sem a CNC hardverét, sem a CNC szoftverét. Ugyanez a helyzet a sejttel is. A sejten belüli folyamatok leírásával nem adtál magyarázatot sem az epigenetikai, sem a genetikai információ eredetére. A matematikai probléma pedig óriási, ha ennek a hierarchikusan tárolt funkcióspecifikus információnak az eredetét a véletlennel vagy a biokémiai szükségszerűséggel akarod magyarázni. Hadd idézzem megint szegény Wigner Jenőt: „a kémiai evolúció lehetetlen”.

  • Veszt says:

    Sziasztok!

    Értem Rui problémáját. De több olyan pont is van amin nem képes túl lépni ez pedig az hogy attól hogy a kémia és a fizika törvényeit használja a biológia még nem lesz önszerveződő.

    “Az a gond, hogy túl antropocentrikusak vagytok. Az emberi intelligencia alkotásaihoz (nyelv, op rendszer, PIN kód) méritek a biológia rendszerét, pedig nem összehasonlíthatóak, hisz a biológia kémiai törvényszerűségekből, kényszerekből levezethető.”
    Itt a hiba, attól hogy a biológia kémiai és fizikai törvényeken alapszik még nem lesz levezethető a DNS kódrendszere azaz a nukleotid és AS sorrend. Semmi sem vezet a kémiai és fizikai törvényekből, hogy DNS vagy fehérje jöjjön létre. Azokat használja de létrejöttének nem oka. Te már egy létrejött rendszer működését magyarázod, annak az összefüggéseit, törvényszerűségeit, de Ádám végig annak létrejöttéről és annak nehézségeiről beszél és erről beszélnek az általa idézet tudósok is és valljuk be erről a biológia nem tud semmit.

    Ezek miatt is nem elégséges érv, hogy a copy-paste új funkcionális információ lenne.

    Kiemelted, hogy az egész rendszer sokkal komplexebb mint gondolnánk, de mégis te hasonlítod a dárdát egy villám által ketté hasított fadarabbá? Akkor most komplex vagy olyan faék egyszerű?

    A fúrófejes példát is félreértetted:
    Éppen hogy hasonlít a fehérjékhez, hogy a fúró összettetsége (fogaskerekek, kapcsolók, elektronika, tekercsek, váz) pont ugyan azt az összetettséget kívánja mint a fehérjéknél a létrejött aktív centrumok. Nem mindegy hogy mi, hol van, angstrom-nyi eltérés is hibát okozhat.

    “A DNS jelöli az aminosavak sorrendjét, de ezen felül az aminosavaknak vannak tulajdonságai is, melyek meghatározzák a belőle felépülő fehérje funkcióját. A DNS-nek ezeket a tulajdonságokat nem kell kódolnia, a lényeg, hogy a tRNS a megfelelő aminosavat rendelje a kódhoz, a többit, a funkciót, megteszi a kémia.”
    Mi is erről beszélünk. A “szeretet” szó fizikája és kémiája nem jelenti a jelentést. Ezért lehet a DNS-RNS-Fehérje rendszert az emberi beszédhez hasonlítani. Hiába beszélsz te az utóbbi esetben emberi asszociációról éppen ugyan az a helyzet a DNS-fehérje kapcsolatnál is. Ez nem asszociáció hanem kapcsolat, egyszerű, kapcsolat, információs, ha úgy tetszik nyelvi kapcsolat. Az asszociáció az más.

    Az hogy kiemeled hogy a biológiai kód kémiailag determinált nem jelenti azt hogy ne lenne olyan nyelvi, információs kapcsolat a DNS-RNS-Fehérje kapcsolatban mint a PIN-kód-zárnyitás kapcsolatban. Te a kémiai determináltság miatt elveted az információs kapcoslatot, de nem tudom mi miatt. Nincs rá semmilyen (legalábbis eddig) érved. Már negyedszer leírtad a kémiai determináltságot, de ez miért jelentené azt, hogy nincs jel-jelentés kapcsolat?

  • Szabados Ádám says:

    Köszönöm, Veszt.

  • dzsaszper says:

    Kedves Lima Rui,

    bár az alábbi részletet már Ádám és Veszt korrektül már megválaszolták, nekifutok én is a saját szavaimmal, kicsit másik irányból, hátha megérted:

    „Minél többet mesélsz a genom működéséről, annál inkább megerősítesz abban, hogy a DNS egy programozási nyelv Külön köszönet a domének említéséért.”
    Szívesen. Az atomok szerkezete is programozási nyelv? +-: hidrogén. +0-: deutérium. Oxigén 3 izotópja: ++++++++——–, ++++++++0——–, ++++++++00——–. Víz: +-+-++++++++——–. Ez nem mond semmit a halmazállapotról. De hát a DNS kód se mond semmit az aminosavak viselkedéséről az eltérő pH-kon.

    Az atomok szerkezete sem kizárt, hogy programozási nyelv legyen, de a fenti szösszeneted mindent csinál, csak nem támasztja alá a dolgot.
    Mi is lenne az atomok szerkezetében található kódsorozat önmagán túlmutató üzenet-értéke? Mint a pendrivodon a bitsorozat, ami a lementett elektronos leveleidet tárolja? Vagy mint a DNS bázissorrendje, ami fehérjék szintézisére ad utasítást?
    Szóval először is, mi a szemantikai tartomány?
    Másodszor is, hol van benne expresszióvezérlés, mint a DNS-ben?
    Épp az expresszióvezérlés a programozás lényege 🙂
    A domének pedig egy olyan eszköznek tűnnek, ami a kifejezőerőt növelik. Mint mondjuk a dinamikus kötés az objektum-orientált programozásban? (bár ez utóbbi példa lehet hogy kicsit jobban sántít, mint a többi).

    Megjegyzés: szerintem az ütvefúró rossz hasonlat volt. Mondd el ugyanezt egy saját célhardverrel és célszoftverrel rendelkező eszközről. Legyen az célra tartó rakéta vagy modern repülőgép…

  • dzsaszper says:

    Ádám,

    két apró dologban reagálnék a kommentjeidre.

    mindenféle bázissorrend létezik, mert a dezoxiribonukleinsav természete olyan, hogy akár citozin, akár guanin, akár adenin, akár timin állhat bármelyik cukorfoszfát molekulán, és tetszőleges sorrendben állhat bármilyen bázispár bármilyen bázispár mellett (ez a valóság). Ez a kontingencia vagy véletlenszerűség pedig létfontosságú.
    Amennyit az ENCODE-nak utánaolvastam, ez nincs teljesen így. Irdatlan kombinatorikus lehetőség van a DNS-kódban, de amennyire értettem, bizonyos báziskombinációk túl hosszú ismételgetése lehetetlenné tenné a kettős spirál elrendezést, szóval ha elég hosszú bázissorozatokat nézünk, lehet néhány tiltott sorozat (a sokmillió/billió/trillió közül).

    Ami a mai élővolágot illeti, az a nagyon durva a dologban, hogy a DNS és egyéb sejtben kódolt információ lekódolja azt is, hogy kell új sejtmagot készíteni (sejtosztódás pl., de az ivarsejtek egyesülése is), és hogy kell felépíteni a hardvert a DNS szoftverének értelmezéséhez.
    Ez minimum annak a bonyolultságnak felel meg, amikor egy programozási nyelv eljut oda, hogy a saját nyelvén megírják a saját fordítóprogramját…

  • Szabados Ádám says:

    dzsaszper,

    pusztán azt akartam állítani, hogy a DNS kontingens, azt nem, hogy végtelenek a kombinációs lehetőségek, vagy hogy semmiféle tiltás nincs a megvalósuló sorrendben. Sőt, a legtöbb kombináció eleve nem is működne, éppen ezért funkcióspecifikus a benne tárolt információ. Köszi a kiegészítést.

  • Lima Rui says:

    Röviden dzsaszpernek: „Mi is lenne az atomok szerkezetében található kódsorozat önmagán túlmutató üzenet-értéke? „ Az elektronok száma megadja mennyire telített a vegyérték elektronhéj, hogy az atom milyen atomokkal tud kötést kialakítani, potenciálisan milyen molekula jön létre. A hasonlatban az elektronok a nukleotidok, a molekula a fehérje, mely az összetételén túlmutató tulajdonságokkal rendelkezik, hasonlóan ahogy a fehérje is több, mint az alkotó aminosavak sorrendje, amit a DNS jelent.
    „Másodszor is, hol van benne expresszióvezérlés, mint a DNS-ben?” Az alapvető kölcsönhatások irányítják a molekulák összeszerelődését, azok szabják meg az új tulajdonságaikat.
    De menjünk tovább: „Te a kémiai determináltság miatt elveted az információs kapcoslatot, de nem tudom mi miatt. Nincs rá semmilyen (legalábbis eddig) érved. Már negyedszer leírtad a kémiai determináltságot, de ez miért jelentené azt, hogy nincs jel-jelentés kapcsolat?”
    Nem vetem el. Arra próbáltam rávilágítani, hogy azon túl, hogy a hasonlat, mint ahogy a neve is mutatja, csupán hasonlat, tehát nem az, amiről szó van, ha nem választják meg jól, akkor elveszíti a lényegét. Ádámék, ha nem is mondták így ki, azzal, hogy a DNS kódot a nyelvhez és operációs rendszerekhez hasonlítják, melyekről tudjuk, hogy az ember, tehát egy tervező intelligencia teremtette, így ezekkel amellett érvelnek, hogy ebből az következik, hogy a DNS kódot is egy intelligencia teremtette. Mivel a DNS kód jel-jelentés kapcsolata kémiailag determinált és ez az egyik hasonlatukra se mondható el, így a hasonlatuk nem helytálló, nem bizonyítja azt, amit szeretnének vele elérni. Másképpen ezeknél az emberi kódoknál az ember kapcsolja tetszőlegesen a jelet a jelentéshez, míg a DNS kód, az aminosav kód és a fehérjefunkció között a kapcsolat fizika-kémiai elrendeltség. Úgy látom, hogy a sok hasonlatban elveszítik a lényeget, vagy eleve nincsenek is tisztában az Ádám által gyakran hangoztatott „funkcióspecifikusággal”. Ádám írta: „Sőt, a legtöbb kombináció eleve nem is működne, éppen ezért funkcióspecifikus a benne tárolt információ.” A két tagmondat között nincs összefüggés. Ezt is Ádám írta: „Egy konkrét PIN-kód (mondjuk az én bankkártyámé) négy egymást követő számjegye olyan kód, ami a funkcionalitástól függetlenül is információ, hiszen a lehetőségek leszűkítése erre a négy betűre, ebben a sorrendben. Ez relatíve komplex információ, de funkcionális specifikussága csak a bankszámlámhoz való hozzáférés kapcsán van.” Pl a PIN-kódnál az összes kombináció működik, mégis funkcióspecifikus. Ádám ellentmond magának, ellentmond az előző idézetnek, ami persze előfordulhat egy ilyen hosszú beszélgetés során, de akkor végülis mi szerinte a funkcióspecifikusság?
    Beszéljünk konkrét példákról. A mikroRNS gének olyan gének, melyek nem transzlálódnak, nem készül róluk fehérje, a funkciójuk az, hogy más gének expresszióját csökkentik az RNS-interferencia révén. A mikroRNS génekről pri-miRNS képződik, melyből kivágódik a kétszálú pre-miRNS, majd a keletkező egyszálú miRNS bázispárosodik a cél mRNS-el és azt lebontja az RNAi rendszer. Hogy a miRNS elláthassa a funkcióját 2 feltételnek kell teljesülnie (persze azon túl, hogy a génről legyen transzkripció, bár a mirtronoknak nincs saját promótere sem): 1) a miRNS 90-100%-ban homológ legyen a célszekvenciával. Ez egyedi. 2) a pri illetve a pre-miRNS-nek duplaszálúnak kell lennie, hogy a megfelelő fehérjék felismerjék. Ez univerzálisan igaz az összes miRNS-re és egyéb kis RNS-re. Az 1) pont könnyű, hisz a miRNS-ek csak 21 (18-22) nt hosszúak, amiből legalább 18 nt-nek kell egyeznie a célszekvenciával. Az emberi genom 30 millió fehérjét kódoló nukleotidjainak (a genom 1%-a) bármelyik 21 nt hosszú csoportjára igen könnyen kialakulhat specifikus 21 nt. 2) Hogy egy RNS duplaszálú konformációt vegyen fel, ahhoz elég, ha az azt kifejező szekvenciának egy szakasza duplikálódik, majd fordítva épül be, így hozva létre az RNS-ben egy hurkot, loopot, melynek a 2 szára bázispárosodik egymással. Egy eléggé repetitív szakaszban, pl promóterben, UTR-ben, beépült transzpozonoknál nem feltétlenül van szükség duplikációra. Egy mirtron esetén a kellő struktúra egy intronban alakul ki, így a létrejövő mikroRNS „génnek” saját promóterrel sem kell rendelkeznie.
    A funkcióspecifikus információt itt egyértelműen magának a kódnak a fizikai megtestesülései, tehát a nukleotidok hordozzák. Magának a kódnak a fizikai és kémiai felépítése határozza meg a funkciót, a sorrendjük és az amúgy spontán képességük a bázispárosodásra (a pri- és pre-miRNS-en illetve a célgénen belül is). Az emberi kódokban és (kód)nyelvekben a jelnek bármi lehet a jelentése. A DNS-kódnál ez nem így van. A mikroRNS-eknél egyértelmű a kapcsolat: az A bázispárosodik a T-vel, G a C-vel, a kétszálú struktúra kialakulásának jelentése így az lesz, hogy az mRNS-t emésszék meg a megfelelő enzimek (a 2szálú RNS-struktúra a vírusokra jellemző). A kód, a jel nem csak hordozza a funkcióspecifikus információt, hanem végre is hajtja, hajtatja. A „szeretet” szó nem szeret senki helyet, csupán jelöli az érzelmet. X miRNS, pl AAAAAGGGGGCCCCCTTTTTA, azért látja el a funkcióját, mert 2 szálú a struktúrája, és a célgén 1000 nukleotidjának egyik exonjáról kifejeződik a TTTTTCCCCCGGGGGAAAAAT-t tartalmazó mRNS. AAAAAGGGGCCCCCTTTTTA az AAAAAGGGGCCCCCTTTTTA-t jelent, nem „szeretet”-et és nem jelent mást, csak hogy kémiailag kapcsolódik a TTTTTCCCCCGGGGGAAAAAT szekvenciához.
    Ugyanígy a promóter is a TATA-boxot és a környező szekiket alkotó nukleotidok révén látja el a funkcióját és a transzkripciós faktor (TF) kötőhelyek is.
    Így jutunk el a ribonukleoproteinekhez ezek RNS-fehérje hibrid-molekulák), melyek azok a fehérjék, melyek kémiailag, a bázispárosodás révén kötődnek a DNS-hez vagy az RNS-hez. Az ezekben a fehérjékben lévő RNS-t a fehérje aminosavai kötik meg kémiai úton. Így működik a riboszóma-tRNS komplex is, ami a transzláció lelke. Így válik egyértelművé ez a kémiai hálózat, mely kémiailag és fizikailag rendeli egymáshoz a nukleotidokat, a tripleteket, kodonokat, antikodonokat az aminosavakhoz, fehérjékhez és azok funkciójához, mely az aminosavak tulajdonságaiból ered és azok sorrendjéből, melyet az antikodonok, kodonok, tripletek és nukleotidok határoznak meg kémiailag. A TF kémiailag kötődik a megfelelő DNS nukleotid szekvenciához, míg a TF fehérje egy másik részéhez kémiailag kötődik a polimeráz, míg a represszorok ugyanígy fizikailag megakadályozzák, hogy a polimeráz kötődjön a promóterhez, szintén kémiailag.
    Ne vesszünk el a részletekben, remélem egyértelmű, amit írok. A jel egyenlő a jelentéssel: a szabályozó elemeknél fizikailag is, lényegében a miRNS-nél is, de az egész transzkripciós-transzlációs rendszeren keresztül a fehérjéknél is, csak áttételesen. Az ATG metionint jelent, még ha fizikailag nem is, csupán reprezentálja azt, de maga az a biokémiai rendszer, ami leolvassa az ATG-t és metionint dob ki, az eggyé teszi a jelet és a jelentést, hisz determinált és kizárólagos.
    Ádám feltette a kérdést: „honnan van maga az információ.”? Eddig erről nem beszéltem, inkább csak arról, hogy MI is az az információ. „Honnan van az az információ, amely az egyik esetben konkrét alkatrészeket dob ki (pl. orvosi műszer fémorsóit), a másik esetben az élet működéséhez szükséges, konkrét összetételű és geometriai alakzatú fehérjéket (pl. hemoglobint, kollagént vagy kazeint)?” Erre próbáltam válaszolni korábban is, csak elvesztem a saját gondolatörvényemben. Szignál peptid (SP) a fehérjék 20%-án van. A feladatuk ugyanaz, hogy a fehérjét kb 5 helyre (ER, mitokondrium, stb) irányítsák. Ehhez csupán annyi kell, hogy az SP-t alkotó aminosavak egy része hidrofób legyen, így tudja eligazítani az SRP, illetve így tudnak beékelődni eme 5 hely hidrofób membránjába. Ennek ellenére több millió-milliárd féle SP van, mondhatni ahány fehérje, annyi SP (persze ortológoknál magas a homológia, de a paralógoknál gyakran nincs is). Millió SP, ugyanazzal a funkcióval. Ha az SP elveszít pár hidrofób aminosavat, akkor egy szint alatt az SRP már nem ismeri fel és marad a fehérje a citoplazmában. Ugyanígy ha nem illeszkedik az SP megfelelően a membránba, akkor is marad egy része a citoplazmában vagy akár az összes. Ez mind információ. Különböző aminosavak pakolódnak egymás után és így a fehérje vagy ide megy, vagy oda, vagy 95%-ban ide, 5%-ban oda. És ugyanannak a fehérjének teljesen más a szerepe a citoplazmában, mint az endoplazmatikus retikulum lumenjében. Pár nukleotid eltérés azt eredményezheti, hogy teljesen megváltozik a fehérje lokalizációja. Idézet a wikipediáról: „Calmodulin mediates many crucial processes such as inflammation, metabolism, apoptosis, smooth muscle contraction, intracellular movement, short-term and long-term memory, and the immune response.[11][12] Calcium participates in an intracellular signaling system by acting as a diffusible second messenger to the initial stimuli. It does this by binding various targets in the cell including a large number of enzymes, ion channels, aquaporins and other proteins.[4] Calmodulin is expressed in many cell types and can have different subcellular locations, including the cytoplasm, within organelles, or associated with the plasma or organelle membranes, but it is always found intracellularly.” A calmodulin SP-je nem illeszkedik ideálisan az ER membrán transzlokonjaiba, így a fehérje 5%-a a citoplazmában marad. Az idézetben láthatjátok, mennyi szerepe van a calmodulinnak. Ha egy ideális calmodulin SP módosul pár mutáció miatt és a fehérje 5%-a a citoplazmában marad, akkor láthatjuk, mennyi funkció módosul, mennyi új funkció alakul ki az adott sejtben. Ez talán nem új információ? Úgy érzem, úgy dobálóztok ezzel a fogalommal, hogy nem vagytok vele tisztában, mit is jelent. Ugyanígy, ha duplikálódik egy gén és az új paralóg más szövetben lesz aktív, ahol eddig nem volt jelen, az talán nem új információ? Mert ha szerintetek nem az, akkor bárhogy is nevezitek, nem a lényegről beszéltek. Persze, az evolúció során nem csak duplikációt feltételezünk. Ádám olyan real time kísérletet szeretne, ahol más is megfigyelhető, miközben tudja, hogy az evolúció (persze, ha van) ezer-millió években mérhető. Ráadásul a kísérleti körülmények, az egyenletes laborkörülmények a genom redukciónak kedveznek. Ez a kísérleti rendszerek hibája, nem az evolúció hiánya. Lebecsülitek a duplikációt, a genom átrendeződést, ahol gének tucatjainak változik az expressziója, miközben akár 1 nukleotid csere fehérjék százainak a működésére lehet hatással!!! Nem hiába vizsgálják a genom helyett manapság inkább a transzkriptomot, vagy a proteomot, hisz az a lényeg, ott látható mi történik valójában a sejtben.
    „honnan van maga az információ.”? egy rossz kérdés. Valami felsőbb tényezőre utal, egy nagybetűs Információra, Istenre, lélekre, valami transzcendensre. A példáimmal rávilágítottam, hogy ez az információ sokféle, sokféle eredetű, de mindenképpen a kémiától függ. Az információ módosul, ha megváltozik a molekulák kémiai szerkezete. Az információ és a hordozó nem választható szét egymástól, ellentétben amit ti hisztek, ezért külön kezelni őket, az információról úgy beszélni, mint valami „több”, az hiba. A molekulák nem azért teszik azt amit tesznek, mert úgy akarják, vagy mert csak, hanem a szerkezetükből adódóan, fizikai és kémiai kényszerek hatására, partnerekkel és a környezettel összhangban működnek. Ezt fontos lenne megérteni.
    Szerintetek azért néz úgy ki X molekula, hogy Y reakciót hajtson végre. Szerintem azért hajt végre Y reakciót, mert úgy néz ki a molekula. Ha máshogy nézne ki, más lenne a szerkezete, akkor Z reakciót hajtana végre. Az Ádám által felhozott 10^195 számú variáció azért hülyeség, mert ez azt jelöli, hogy B molekula kialakulására mennyi az esély, ha a jelenből visszatekintünk egy kezdeti állapotra. De azon kívül, hogy a legelső fehérjék biztosan jóval egyszerűbbek voltak a mainál, a lényeg a következő: ha a B molekula máshogy alakul ki, ha a 10^195 lehetőség közül más valósul meg, akkor B molekulának más lenne a funkciója. Mivel a funkció maga a molekula, nem elválasztható a kettő, ezért nem is B-nek hívnánk, hanem C-nek. És van is C molekula, csak az emberben 20 ezer féle fehérjemolekula van, az élővilágban több milliárdnyi. A fehérjék 40-50%-a (most nem nézek utána, hogy mennyi) konzervált, az élővilág majd minden jelenlegi és kihalt fajában benne van/volt, mégis minden fajban máshogy néz ki ez a fehérje. 10 millió fajjal számolva (és ennél jóval több van, főleg a baktériumokkal együtt) csak egy fehérjénél ez 10 millió, 10^7 féle molekula. 10^7 molekula, ami ugyanazt csinálja. Mivel a fehérjedomének rendelkeznek funkcióval, így ennél jóval több féle molekula is elképzelhető, csak rendelkezzen a megfelelő doménekkel (és más domén ne zavarja).
    Az általam vizsgált fehérje 9 transzmembrán doménnel rendelkezik, 1 ER lokalizációs szignállal, 1 szignál, ami a Golgiból visszavezeti az ER-be, egy kb 10 aminosavas calmodulin kötőhely és 4+2 aminosav csupán az, ami a peptidáz funkciót hajtja végre. Azt mondanátok ti, hogy a fehérje funkciója az, hogy peptideket hasítson el, azaz peptidáz. 4+2 aminosav létrejöttéhez bizony nem kell túl sok kombinációs lehetőség. De hogy a fehérje úgy működjön, ahogy működik, azokat a célpontokat vágja el amiket elvág, ahhoz a többi doménre is szükség van. De ha azok nincsenek a peptidáz funkció akkor is működik, akkor is vág peptideket, csak másokat, leginkább azokat amik a citoplazmában vannak. De a citoplazmában is van peptidáz, a C fehérje a 10^195 számú variációból, vagy a ZS.
    Ha az a kérdésed, hogy történt az abiogenezis, hogy honnan ered a genetikai kód, az „információ”, akkor az a vicces helyzet áll elő, hogy egy 3,8 milliárd éve bekövetkezett eseményről szeretnél bizonyosságot szerezni, miközben csak azt fogadod el bizonyítéknak, ami a szemünk előtt játszódott le. Szerves molekulák elég rosszul fosszilizálódnak, közel a „sehogy”-hoz. De ha laborban életet állítanánk elő szerves molekulákból abiotikus úton az se bizonyítaná, hogy az élet így jött létre a Földön. De pár érdekesség, amit mostanában olvastam: nem feltétlenül kódolt 20 féle aminosavat a genetikai kód, lehet, hogy csak 4 volt és később diverzifikálódott, ahogy a változatosabb fehérjék létrejöttéhez egyre több aa volt ajánlatos. Illetve az első nukleotid tripletek eleve aminosavakhoz voltak kötve stabilitási okokból, aminoacyl csoportok a nukleotidokon, így egyszerre nőtt a nukleotid és a fehérje lánc, a 2 féle kód egy egységben, mely később vált külön. Ez egybevág azzal, amit az előzőekben kifejtettem a kémiai kapcsolatról. Az se elvetendő, hogy az első „élőlények” nem sejtes szerveződésűek voltak, hanem kompartmentalizált genetikai elemek, inkább hasonlítottak a mai vírusokhoz. Bioaktív molekulák halmaza.
    „Te valamiért ragaszkodsz ahhoz, hogy ez a sorrend kémiailag determinált, de ehhez visszafelé érvelsz: azt mutatod meg, hogy a bázisok hidrogénkötéssel kapcsolódnak a bázispárjukhoz, majd azt mondod el (néhány ad hominemmel tűzdelve), hogy az egyik bázissorrend nem egyenértékű a másik bázissorrenddel, hiszen az egyik felbontásához több energiára van szükség, mint a másik felbontásához (más, amiben C és G képez H-hidat, más, amiben A és T).” Nem értetted meg, amiről beszéltem. „A nukleinsavak olyan tulajdonsággal rendelkeznek, hogy kémiai szempontból a DNS bármely kombinációs mintája egyenértékű.”(Bernd-Olaf Küppers)” Ezt az állítást cáfoltam, bár bevallom, inkább kötözködés volt, hisz a vita kapcsán tudtam, hogy miért linkelted, így feltételeztem, hogy mire gondol a szerző, de a megfogalmazás akkor is helytelen. Nem kémiai szempontból egyenértékű, hanem biológiai, vagy genetikai szempontból. Tisztában vagyok vele, hogy egymás mellett bármilyen bázisok állhatnak. Valójában elég sértő, hogy azt feltételezed, hogy nem így van, így vagy totál hülyének nézel vagy nagyon nem érted, amit írok. Később írod a nukleotidok kapcsán: „a legtöbb kombináció eleve nem is működne”. Így van. Potenciálisan bármilyen sorrendben állhatnak a nukleotidok (elsősorban a fehérjekódoló részről van szó), a gyakorlatban mégis csak egy része valósul meg. Miért? Mert a több változat hibás, nem marad fent, az azt hordozó egyed elpusztul. Miért? Mert az értelmetlen kód értelmetlen fehérjét kódol, azaz a fehérje kémiai szerkezete nem segíti elő, sőt, inkább hátráltatja a túlélést. A nukleotid sorrend maga nem determinált, de mivel a jelentése, a fehérje szerepe kruciális, annak a kémiai funkciója a lényeg, így a megfelelő kémiai funkciók halmaza, az összfehérje, a proteom meghatározza a nukleotid sorrendet, pontosabban az életre megfelelő nukleotid sorrend, a megfelelő DNS kód marad fent. Ez a lánc, ahogy generációról generációra módosul a jel és a jelentése, ahogy a jelentés révén (fehérje funkciók) egyre életrevalóbb lesz az egyed, a faj, a DNS kód, ez a rendszer lenne az evolúció.
    „„Ahogy a floppylemez, maga a DNS is hardver, döntő jellemzője azonban nem az anyag, amiből a DNS felépül, hanem a bázispárjaiba írt üzenet. „ Ahelyett, hogy továbbra is ugyanazt írnám le sokadszorra, inkább megkérdezlek téged (bár már próbáltam megválaszolni a kérdést az előzőekben): mi a bázispárokba írt üzenet? Szerinted. Hasonlatok nélkül. Mi az információ? A jelentés? Ez hogyan nyilvánul meg? Mi a lényege? Stb…

  • dzsaszper says:

    Kedves Lima Rui,

    a nukleotidok nem alkotóelemei a fehérjéknek, és ez egz óriási különbség!
    A fehérjék kódolását a nukleotidok csak leírják, utastást adnak.
    Az elektronok a molekulák tuélajdonságait pedig közvetlenül meghatározzák. mindenféle külső olvasó eszköz és fordítóprogram megléte nélkül.

    Bocs, se a lándzsa, se az ütvefúró nem összemérhető a repülőgéppel, továbbra sem 🙂

  • dzsaszper says:

    Kedves Lima Rui,

    „Másodszor is, hol van benne expresszióvezérlés, mint a DNS-ben?” Az alapvető kölcsönhatások irányítják a molekulák összeszerelődését, azok szabják meg az új tulajdonságaikat.

    tulajdonságok meghatározása — alkotóelemnként — persze megvan.

    De nem mindegy, hogy arról beszélünk, hogy a só meghatározza a leves ízét, vagy arról, hogy a receptben szereplő utasítás a só hozzáadására határozza meg a leves ízét 🙂

    Nem értem, az atomoknak mi közük az utóbbihoz.
    Míg a DNS gyakorlatilag a fehérjék receptgyűjteménye, ráadásul olyan expresszióvezérléssel, hogy melyiket mikor kell szintetizálni.
    Ilyen expresszióvezérlést egy külső szemantikai tartományon — a Polányi féle kettős meghatározottság mentén — mutass az atomokra.

  • dzsaszper says:

    Kedves Lima Rui,

    kérdésedre
    mi a bázispárokba írt üzenet?

    megismétlem korábbi válaszom másik posztból, ezek szerint elsiklottál felette:
    az üzenet expresszióvezérelt utasítás fehérjeszintézisre: tehát utasításgyűjtemény: milyen fehérjét milyen körülmények között kell készíteni.

  • Lima Rui says:

    Kiegészítésként: a természetes kiválasztódás választja ki a túlélő egyedeket, így a genomokat, géneket. De nem a gének látják el a túléléshez szükséges funkciókat, hanem a fehérjék. Persze a gének funkciója, azaz a fehérjék kódolása is létszükséglet, de a környezettel, a szelekciós ágensekkel a fehérjék vannak közvetlen kapcsolatban, azok a fehérjékre hatnak, illetve azokra a fehérjék hatnak. Így a szelekció a megfelelő élőlény kiválasztásával a megfelelő proteomot választják ki, amellyel a megfelelő genom jár. A proteom jóval több a genomnál, a genom csupán egy leegyszerűsített reprezentánsa, de annak igen alkalmas és megfelelően örökíthető. A genom az aminosav sorrendet kódolja, de nem az aminosavak tulajdonságait, mely ugyanannyira fontos, de az eredendően része az aminosavaknak. De az aminosavaknak,a fehérjéknek van funkciója, azt választja ki a természet, de annak a reprezentánsa, a DNS öröklődik. De mivel a kettő olyan erősen kötődik, a genom és proteom, annyira egyértelmű a kettő közötti kapcsolat, hogy a genom kiválóan leírja a proteomot, illetve épp eléggé, pont annyira, hogy az megfelelően működjön. Ha mégsem, akkor nem marad fent, a természet kiszelektálja a proteomot, a biokémiát és annak reprezentánsát.

  • dzsaszper says:

    Kedves Lima Rui,

    amit a legutolsó kommentedbe írtál, az ugyan éppenséggel igaz, de sok köze se az Ádámmal, se a velem folytatott vitádhoz nincs szerintem.

  • Szabados Ádám says:

    Lima Rui,

    az a baj, hogy szinte egy az egyben az október 8-i hozzászólásomat kellene most megismételnem. Nem érted az érvemet.

  • Szabados Ádám says:

    Mi az információ? A jelentés? Ez hogyan nyilvánul meg? Mi a lényege? Stb…

    Hogy mi az információ, arra a kérdésedre már sokszor válaszoltam. Az információ egyik definíciója az, hogy a lehetőségek leszűkítése. A jelentés pedig valamiféle viszony A és B között, melyben B más, mint A, mégis van valamiféle egyenértékűség A és B között. Úgy is lehet mondani, hogy A-nak egy másik kontextusban üzenetértéke van. A DNS esetében az információ az aktuális bázissorrend, annak jelentése pedig az, hogy a bázissorrend aminosavakat kódol, amelyekből az élethez szükséges fehérjék épülnek. Az információ a bázissorrend, a jelentés a megépült fehérjék.

    Nem értetted meg, amiről beszéltem. „A nukleinsavak olyan tulajdonsággal rendelkeznek, hogy kémiai szempontból a DNS bármely kombinációs mintája egyenértékű.”(Bernd-Olaf Küppers)” Ezt az állítást cáfoltam, bár bevallom, inkább kötözködés volt, hisz a vita kapcsán tudtam, hogy miért linkelted, így feltételeztem, hogy mire gondol a szerző, de a megfogalmazás akkor is helytelen. Nem kémiai szempontból egyenértékű, hanem biológiai, vagy genetikai szempontból. Tisztában vagyok vele, hogy egymás mellett bármilyen bázisok állhatnak. Valójában elég sértő, hogy azt feltételezed, hogy nem így van, így vagy totál hülyének nézel vagy nagyon nem érted, amit írok.

    Ha tudtad, miről beszélek, de kötözködésből úgy tettél, mintha nem értenél, ne csodálkozz, ha én meg olyanról győzködlek, ami számodra nyilvánvaló (és persze, hogy az).

  • Lima Rui says:

    “Ha tudtad, miről beszélek, de kötözködésből úgy tettél, mintha nem értenél, ne csodálkozz, ha én meg olyanról győzködlek, ami számodra nyilvánvaló (és persze, hogy az).” Ezzel (ügyetlenül) arra akartam rávilágítani, hogy ha pongyolán megfogalmazott állításokból szerzed a tudásodat, akkor nem kell csodálkozni, hogy hibásan értelmezed a dolgokat.
    “Az információ a bázissorrend, a jelentés a megépült fehérjék.”
    Tehát a genom 1%-a lenne információ? Azon kívül, hogy Te ennek pont az ellenkezőjét állítod, tényleg nem így van. Információ a miRNS gének is, a promóter is az (hogy hol, mennyi expresszáljon a génből), enhancerek, TF kötő helyek, hiszton kötő helyek, eu- és heterokromatin.
    Ahogy a korábbiakban írtam a fehérje jóval több információt hordoz, mint a bázissorrend maga. Az csupán egy öröklődő reprezentánsa a fehérjék aminosav sorrendjének. A funkció az elsődleges, melyet az aminosavak kémiája és sorrendje határoz meg. Ez utóbbit kódolja a DNS, az előbbi meg jellemző az aminosavakra. A mikroRNS-eknél vagy még inkább a promóternél ez nyilvánvaló, ahol az információhordozó maga a funkció végrehajtója is. A DNS-fehérje ennek egy jóval fejlettebb verziója, de attól még ugyanaz.
    “Nem érted az érvemet.” Ez előfordulhat. Én a biológiáról beszélek, te meg az operációs rendszerekről és az ütvefúróról.
    De lendülhetünk tovább. Az eredeti tanulmányban nem foglalkoztak az előemberi populációdinamikával, se a szociális viselkedésükkel: hány utódja van egy egyednek, egy egyed hány másikkal párosodik élete során, hogy a domináns hím ejti teherbe a legtöbb nőstényt, így ha az ő erős fitnesze egy pozitív mutáció miatt ilyen erős, akkor azt nagyon nagy arányban adja tovább a következő nemzedéknek. Azzal se foglalkoztak, hogy az emberi evolúció során hány “bottleneck” effektus történhetett (kettőről tudunk az elmúlt csupán 150 ezer évből), amikor is a populáció egyedszáma jelentősen lecsökken, így sok allél, jelleg eltűnik, a többi meg feldúsul (akár véletlenszerűen, de gyakran épp a pozitív fitneszt okozók).
    “Először is egy kis populációban hosszú időre van szükség ahhoz, hogy egy specifikus nukleotid (genetikai „betű”) helyére véletlen mutáció révén egy másik nukleotid kerüljön.” Minden előemberben 40 ilyen mutáció volt. A domináns hím ezeket pár nemzedék alatt elterjeszti a csoporton belül. A cikk azzal se foglalkozott, hogy mekkora, milyen összetételű csoportok alkotják ezt a 10 ezer fős populációt. Hisz az valószínű, hogy ennyi ember, egyszerre nem mozgott együtt soha 10 ezer évvel ezelőttig. “Másodszor, nagyságrendekkel több időre van szükség ahhoz, hogy egy specifikus nukleotid láncból véletlen mutáció révén egy másik specifikus nukleotid lánc alakuljon ki.” Ez így nem értelmes. Egy darab pontmutáció is egy specifikus nukleotid láncból egy másik specifikus nukleotid láncot csinál. Vagy mire gondolsz? Egy teljesen új gén létrejöttére egy nem kódoló szakaszból? Mert más úton is jöhetnek létre ám gének. “Harmadszor, az új nukleotid láncot (új értelmes „szót”) a genetikai sodródás nagy valószínűséggel kiszórja, ezért több alkalommal kell létrejönnie ahhoz, hogy megkapaszkodhasson a populációban.” Ez nettó hülyeség. Persze, hogy több milliárd év jön ki a számítás alapján, ha ugyanannak a nukleotid láncnak többször is létre kell jönnie. De ilyet nem állít senki, csak ez a tanulmány. Ha eltűnik, akkor eltűnik, biztos rengeteg új szekvencia, még pozitív is eltűnik. De sok rögzül, pl mert előnyös, de neutrális vagy hátrányos is rögzülhet, ha kapcsolva van pozitívval, ill eleve csupán a kapcsoltság miatt. A tanulmány a genetikai kapcsoltsággal se számolt, se azzal, hogy a 23 kromoszómánkon eltérő számú gének vannak és eltér a nukleotidok száma is, ráadásul a 2 nem feltétlenül korrelál. “És végül, a megkapaszkodott „szó” esetében további hosszú időre van szükség ahhoz, hogy az előnyös mutációt a természetes szelekció fixálja a populáción belül. ” Ennek megállapításához szólni kellett volna a populációdinamikáról.
    A genomban vannak mutációs hotspotok is, ahol gyakoribbak a mutációk.
    Írtad valahol azt is, hogy a konvergencia gyakran ellentmond a vélt evolúciónak. Mégis hol? A konvergencia fenotipikus jelleg, a genetika és szekvenálás felfedezésével persze, hogy rájöttek, hogy néha amit konvergenciának hittek az valójában diverzifikáció és a többi jelleg divergált, vagy épp fordítva. Ez nem mond ellent az evolúciónak.
    És nem tudok elmenni az összeesküvés-elméleted mellett sem, hogy valójában sok biológus lehetetlennek tartja az evolúciót, csak nem merik felvállalani a karrierjük miatt. Lehet, hogy az amerikai mikrobiológus professzor ismerősöd jár valami klubba, ahol ilyenekről susmorognak, de ne vedd azért készpénznek minden szavát. Lenne egy evolúció-lobbi? Milyen érdekük lenne emellett? Épp az lenne hatalmas durranás a karrierjüknek, ha kiderítenék, hogy evolúció nincs vagy nem úgy van, ahogy eddig hittük. Ha nem hisznek az evolúcióban, akkor nem nyilván nem kutatják azt (hisz nincs, erre nem vesztegetik az idejüket), így amit kutatnak, abban nem feltétlenül kell leírni egyáltalán a szót, hogy “evolúció”. Ez az összeesküvés-elmélet csupán azért kell, hogy az evolúciót támogató 94,4%-ot lecsökkenthesd és hogy hivatkozhass a maradék 5,6%-ra. És Paul Davies fizikusra. Ráadásul ez az 5,6% az amerikai tudósokra vonatkozik, ahol sok helyen nem kötelező tanítani az evolúciós elméletet és nem azért mert felvilágosultak, hanem mert a 19. században rekedtek. A vallásos nevelést nehéz levetkőzni, gyakran az se tudja, aki akarja, ez teljesen áthatja a világnézetüket. Lefogadom, hogy az 5,6% jelentős része vallásos nevelést kapott és azok is. A világ többi részével együtt úgy tudom, hogy ez a 94,4% már inkább 98%. Ettől még lehetne a kisebbségnek igaza, de akkor sem állja meg a helyét, hogy rám pirítasz azért, mert kétségbe vonom a 2-5,6% állításait, sőt, akár a hozzáértésüket is, mint azokét, akik a fenti cikket írták. Augusztusban jártam nemzetközi konferencián és senki se vonta kétségbe az evolúciót, többen is beszéltek róla az előadásukban. Persze, tudom, nem merik nyilvánosan. A tágabb munkahelyemen, a Szegedi Biológiai Kutatóközpontban hetente van előadás, gyakran az evolúcióról vagy az is szóba kerül, mégsem kérdőjelezi meg senki a több, mint 300 főből (persze egyszerre nincsenek ennyien jelen). Pedig gyakran van bátorságuk már leközölt cikkeket bírálni, akár aki írta, személyesen az arcába, de a “szent evolúciót” már mernék? Ugyan már. Neked van egy amerikai mikrobiológus professzor ismerősöd, aki tagadja, nekem meg több száz, a világ több részéről, professzor is, akadémikus is, USA és brit akadémikus is, aki meg egyértelműnek veszi. Persze lehet, hogy az ágyuk alatt egy lepisilt, összetépett Darwin kép hever

  • Szabados Ádám says:

    Három gyors megjegyzés:

    Nehéz úgy vitatkozni, ha folyton a szőrszálakat hasogatod. Sokszor elmondtam, hogy a DNS bázissorrendje mellett epigenetikai információ is van a sejtben. A fehérjék nukleotid bázissorrend alapján való kódolása a legnyilvánvalóbb példa az információra és a jelentésre, azért említettem azt.

    A biológiában jelenleg a neo-darwinizmus az uralkodó paradigma, a legtöbb biológus ezen a paradigmán belül dolgozik. Semmilyen összeesküvés-elméletben nem hiszek, de a tudomány világának szociológiai és szociálpszichológiai dinamikájáról sem szeretnék naivan gondolkodni.

    Ahogy a nemsokára kezdődő londoni konferencia ténye is mutatja, valamiféle evolúcióban lehet úgy is hinni, hogy valaki elveti a neo-darwinista szintézist. Ha pedig evolúció alatt a mutációk általi variációkat értjük, azt lényegében senki nem is tagadja.

    Most nincs időm hosszabban válaszolni a többire.

  • dzsaszper says:

    Kedves Lima Rui,

    egyrészt. száámomra beszédes. hogy ismét nem reagálsz a válaszomra, miszerint
    1. a DNS-ben lévő információ egy utasításgyújtemény, mit mikor kell szintetizálni,
    2. mi az elektronok kódolásánál az a szemantikai tartomány, amit a Polányi féle kettős meghatározottság elve mentén az általad felvetett kód vezérelhet.

    Hadd reagáljak Ádámnak adott válaszodból csak erre:
    “Az információ a bázissorrend, a jelentés a megépült fehérjék.”
    Tehát a genom 1%-a lenne információ? Azon kívül, hogy Te ennek pont az ellenkezőjét állítod, tényleg nem így van. Információ a miRNS gének is, a promóter is az (hogy hol, mennyi expresszáljon a génből), enhancerek, TF kötő helyek, hiszton kötő helyek, eu- és heterokromatin.
    Ahogy a korábbiakban írtam a fehérje jóval több információt hordoz, mint a bázissorrend maga

    Itt tökéletesen félreérted Ádámot, majd a saját félreértéseddel vitázol.

    Az mRNS egy másolat, azzal most egyelőre nem foglalkoznék — az egyetlen érdekes pont az lehet, hogy szükségszerű hibaforrás, másolási hibák előfordulnak ahol másolat készül…
    Ami a promótereket, enhancereket stb. illeti, azok épp azt vezérlik, mikor — milyen környezetben — milyen fehérjék épüljenek. A megépült fehérjék mindig adott környezetben épülnek, tehát mindezek hatása a megépült fehérjékben már benne van.

    Ezzel együtt, szerintem jobb a DNS vezérelte fehérjeszintézis kapcsán a DNS információtartalmát utasításokként meghatározni — a dolognak nyilván csak akkor van értelme, ha van am tudja i értelmezni és végrehajtani az utasításokat.
    A DNS nyelve valójában ezen utasításoknak a nyelve — ismétlem, expresszióvezérlést beleértve –, és innentől aligha tudunk továbbhaladni a vitában minimális nyelvészeti ismeretek nélkül.

  • Lima Rui says:

    3 millió év alatt 150 ezer generáció (20 év/generáció). Generációnként 10 ezer egyeddel és egyedenként 40 spontán pontmutációval számolva 60 milliárd pontmutáció jön ki. Azaz mind a 3 milliárd emberi nukleotid 20-szor mutálódott 3 millió év során, minden pozícióban 5-ször bukkant fel függetlenül mind a 4 féle nukleotid. És ezzel csak a pontmutációkat számoltam!
    A valószínűség számításról még ennyit: a téged létrehozó spermium 200 millió társa előtt jutott célba. A létrejöttöd esélye 1 volt a 200 millióhoz, mégis te jöttél létre. De ugyanígy a többi spermiumnak is 1 a 200 millióhoz volt az esélye, de ők nem jártak sikerrel, akárcsak a többi, 1 híján 200 millió. (Persze a spermiumok csak 1-10%-a működik megfelelően, de ez is 2-20 millió spermiumot jelent, a lényegen nem változtat.) 1 a 200 millióhoz volt az esélyed. Szóval 200 millió év alatt a létrejöttöd valószínűsége 100% (1 év/gyerekkel számolva, persze más tényezők is szerepet játszottak abban, hogy te te vagy, ráadásul nem érik meg ennyi petesejtje egy nőnek, sőt, azok mindegyike is más és más génállományú). Még sem kellett rád várni 200 millió évet. Na, ilyen a valószínűség számítás, talán ezért nem alkalmas a biológia, az evolúció történetének a visszafejtésére. 1 a 200 millióhoz nem túl nagy szám, mégis létezel.
    A 2 bekezdésemet egybe is moshatjuk. Ha 200 millió spermium van egy adag ondóban, mindegyik hordozva a maga 20 spontán pontmutációját (hisz haploid), akkor csupán egy (!!!) adagban potenciálisan 4 milliárd pontmutáció lehet, azaz akár minden egyes nukleotid mutálódhat valamelyik sejtben. (Persze sok mutáció letális vagy csökkent életképességet okoz, így ezek a spermák nem is jutnak célba, vagy abortál az embrió.) A 200 millióból te értél célba a magad 20 pontmutációjával (és egyedi genotípusoddal, a maga rekombinációival együtt), a többi 1 híján 200 millió a 4 milliárd potenciális pontmutációjával nem. Vagy később (vagy előbb), amennyiben van testvéred, de ő anyai részről más haplotípust kap, a maga valószínűségével, 400 ezer petesejt/nővel számolva (bár ebből 400 érik meg). Csupán 1 generáció, azaz 5000 férfi csupán 1 adag ondójában összesen potenciálisan 20 ezer milliárd pontmutáció történhetett. 6000 mutáció minden pozícióban. Ebből ugyan elenyésző rész valósul meg és az is véletlenszerű, így mégis mit akar a tanulmányod? Az ötös lottót is megnyerik évente, pedig minden húzásnál 1 a 45 millióhoz az esély. De a születésed az más: akkor vagy egy másik alkalommal, de a szüleidnek születik egy gyereke, ez kb determinált (persze egyéb körülmények bezavarhatnak), így az biztos, hogy egyféle keverék genotípus, a maga 40 mutációjával megszületik, de az, hogy pont te, az véletlen, az esélye elenyészően kicsi, mégis te lettél. A fehérjék közel végtelenül sok lehetséges konformációja közül is 1 valósul meg, és annak az lesz a funkciója, amit a konformációja ad. Ha működik, illetve a működés előnnyel jár a szervezet számára. A szüleid se pontosan téged akartak, a magad geno- és fenotípusával, de te lettél. Ugyanígy van a fehérjéknél is.

    Kedves dzsaszper
    Azért nem válaszoltam, mert hasonlatokban utazol, nyelvészkedsz, amihez nem értek, de nem is releváns. Érdekes ugyan a DNS kód és a nyelv illetve operációs rendszerek közti hasonlóság, de épp elég különbség is adódik ahhoz, hogy ne azok függvényében vitatkozzunk a biológiáról vagy evolúcióról. A nyelvhez akkor már jobban hasonlít a Dawkins-féle memetika. Valójában minden eddigivel a különbséget akartam megfogni a genetika és a memetika között, ahová a nyelvészet is tartozik (Dawkins szerint), vagy amihez rokonítható. Továbbá a nyelv fejlődése igen bonyolult, vannak benne természetes és mesterséges hatások is, eleve egy fajta továbbfejlesztett kommunikációs forma. Hol a határ a nyelv és kommunikáció között? A cerkófok 12 szavas nyelve az nyelv? A gorillák kommunikációja nyelv? Hisz emberi nyelvre, jelbeszédre megtaníthatóak? Az első emberi nyelv kialakulása természetes, nem emberi folyamatok, nem intelligencia által vezért volt? Mert ha a nyelv, az első protonyelv kialakulását nem intelligencia irányította (de kellett hozzá a használó faj, egyedek intelligenciája!), akkor a DNS kódhoz való hasonlítása az evolúciót elméletét erősíti. De a nyelv(ek) eredete egy külön tudományterület, nem akarok belemenni. Meg az is fontos része a vitának, hogyha a feltételezésetek szerint nincs evolúció, a fajokat teremtik, akkor a kommunikációra, a nyelvre való készségüket is teremtik, akkor minden élettel kapcsolatos dolog teremtett, nem kialakult, így nincs is miről vitatkozni.
    „1. a DNS-ben lévő információ egy utasításgyújtemény, mit mikor kell szintetizálni,” Igen.
    „2. mi az elektronok kódolásánál az a szemantikai tartomány, amit a Polányi féle kettős meghatározottság elve mentén az általad felvetett kód vezérelhet.” Nem ismerem Polányit, se az elvét.
    Mint sokszor kifejtettem a hasonlatok félreviszik a témát, bánom, hogy én is belementem az atomokkal, elektronokkal. Amennyire tudjuk az élet egyedülálló, páratlan (de ha van is máshol élet, bizonyára van, a földi élet akkor is egyedülálló, akárcsak a többi, ami van), így nincs is mihez hasonlítani, max egyes részeit tudjuk rokonítani, de nem a teljes képet.
    A kvarkok hármas szerekezete határozza meg, hogy a részecske proton vagy neutron vagy más legyen. Ezek összessége határozza meg az atomoto. Minden szint újabb tulajdonságokkal rendelkezik. A protonok (írhatnék kvarkot is) száma (ez a DNS kóddal analóg) meghatározza, hogy mi lesz az atom (ez az aminosav analógja). De az atomnak más tulajdonságai vannak, ami nincs a protonba „kódolva”, ez egy magasabb szint, ez lesz a vegyérték elektronhéj (hisz a p+ szám meghatározza az e- számot). Az atomok a vegyérték e- héj alapján kapcsolódnak egymáshoz, létrehozva a molekulákat (fehérjéket), amelyeknek olyan tulajdonságai vannak, amit se a kvarkok, se a protonok, se az atomok nem hordoznak, mégis, a kvarkok sorrendje, kapcsolata önmagukban meghatározzák a molekulát, amelyben a részecskék sorrendje (amelyet a kvarkok leírnak) ugyanolyan fontos, mint a hierarchia szintje, azaz a hierarchia által adott tulajdonság (így az extra tulajdonság, ami az aminosavakban van, amiért az aminosav, amiért Met, Gly, stb). Mindezt a láncot, az értelmezési tartományokat az alap kölcsönhatások határozzák meg. Az elektromágnesesség engedi, hogy a 2 H+ kapcsolódni tudjon az O- -hoz, így kódolva a vizet. A gyenge kölcsönhatás okozza a radioaktivitást. Az univerzumban nem lenne lítiumnál nehezebb elem, ha rengeteg hidrogén egy felhőbe gyűlve nem fejteni ki akkora gravitációt, hogy létrejöjjön egy csillag és benne a termonukleáris fúzió ne hozza létre a periódusos rendszer többi elemét. pedig csak egy rakás hidrogén. Ezek mint újabb rétegek a kvarkok egyszerű kódján, újabb tulajdonságok. Ahogy a tRNS-riboszóma komplex letapogatja a nukleotidokat és rendel hozzájuk megfelelő aminosavat, úgy rendel az elektromágnesesség is egy atom mellé egy másik, megfelelő atomot, ami szintén többféle lehet. Valójában a DNS és a fehérjék is egy újabb hierarchia ezen, egy újabb, még bonyolultabb szint, mely sok elemében hasonlít az előző szintekhez, de annál jóval komplexebb. Ez még nem jelenti azt, hogy létrehozták, max annyira, mint amennyire az alatta álló szinteket.
    „Az mRNS egy másolat,” Az általad bemásolt idézetemben miRNS van, azaz mikroRNS. persze az is másolata a mikroRNS génnek, de azért beszéltem a miRNS-ről mert annak a nukleotidjai egyértelműen, egyben az egyben megfeleltethetőek a DNS nukleotidjainak, a bázispárosodás révén. A miRNS-eknél, akárcsak a promótereknél maga a kód hordozói, a nukleotidok hordozzák a funkcióit is. Itt egyértelmű, hogy nem választható szét a kettő.
    „Ezzel együtt, szerintem jobb a DNS vezérelte fehérjeszintézis kapcsán a DNS információtartalmát utasításokként meghatározni — a dolognak nyilván csak akkor van értelme, ha van am tudja i értelmezni és végrehajtani az utasításokat.
    A DNS nyelve valójában ezen utasításoknak a nyelve — ismétlem, expresszióvezérlést beleértve –, és innentől aligha tudunk továbbhaladni a vitában minimális nyelvészeti ismeretek nélkül.” Csakhogy a biológia nem nyelvészet. A promótereknél jól látható miket próbáltam kifejteni az előbb. A promóter nukleotidjaihoz kötődik a polimeráz. A promóter nukleotidjaiban az az utasítás van, hogy a sorrendjük alkalmassá tegye azokat a polimeráz kötődéséhez. A polimerázban az az utasítás, hogy kötődjön a promóterhez. Ezek az utasítások mind-mind kémia. A (hipotetikus) RNS-világnál is egyértelmű a kép, ott a kódoló RNS maga hajtja végre az utasítást, hasonlóan, mint a promóterek, de egyben fejlettebben is, hisz sokkal diverzebb funkcióra képesek. A fehérjék előképei, de a ribozimekben benne van a kód is. A jelenben te nyelvnek látod ezt a bonyolult folyamatot, de ha elfogadva az abiogenezist (túllendülve azon mennyire lehetetlen e vagy sem), akkor ott spontán létrejöttek a funkciót végrehajtó molekulák és velük egyértelmű kapcsolatban a kód, vagy egy molekulában az RNS-világnál, vagy kötődve egymáshoz, amino acidizált nukleotidokként. Nincs külön jel és jelentés, csak annyi, hogy a kő jelentése az, hogy nehéz, vagy hogy a 2 proton, 2 elektron jelentése a hélium. A jel és jelentés ugyanaz. Az evolúció ezt aztán 3,8 milliárd év alatt jócskán megcsiszolta. „van am tudja i értelmezni és végrehajtani az utasításokat.” A nukleotidláncok a bázispárosodás révén képesek maguk megsokszorozódására. Ez kémiai tulajdonságuk, és lényegében most is így „szaporodnak”, csak ribonukleoproteinek irányításával. Mint amilyen a DNS-polimeráz, mely a megfelelő közegben, szabad nukleotidok mellett bármilyen DNS-t lemásol, így működik a PCR reakció. Persze ennek is bázispárosodás az alapja. Képzelj most el egy ribozimet, amelyik saját magát képes lemásolni, hogy aztán a másolat is másolhasson. Hopp, ezt csinálja a sima bázispárosodás is, csak rövid láncokkal. Az új komplementer lánc elválik a régiről, majd az ő szintetizálódó komplementer lánca megegyezik az eredetivel. Ezek a funkciók a molekulák eredendő tulajdonságaiból fakad.

  • Lima Rui says:

    Részvétem, Ádám, az apukád miatt. Az előző hozzászólásom nem volt a legjobban időzített. Általánosságban gondolkodtam, habár hozzád címeztem.

  • Szabados Ádám says:

    Lima Rui,

    mivel nagyon szűkében vagyok az időnek, és most már csak körbe-körbe forgunk, nem látom értelmét folytatni a vitát. Köszönöm, hogy elmondtad a véleményedet. Ha gondolod, legyen tiéd az utolsó szó. Én csak annyit tennék még hozzá, hogy szerintem továbbra is összekevered a komplexitást a funkcionálisan specifikus komplexitással, amelyek probabilitásáról egészen máshogy kell gondolkodnunk (l. itt), és valamiért nem érted, mi a jelentősége annak, hogy a DNS-ben információs kód van. (A kód kifejezés nem tőlem származik, hanem Francis Crick-től.) Egyáltalán nem csak hasonlatról vagy metaforáról van szó, a DNS bázissorrendje valódi információs kód. Te ezt a kódot rendre a működésével magyarázod, eredetét pedig véletlen másolási hibákkal, ismétlődésekkel stb. Előbbi nyilvánvaló logikai hiba, utóbbit nem tartom komolyan vehető hipotézisnek.

    (Köszönöm a részvétnyilvánításodat.)

  • Lima Rui says:

    Akár benned van a hiba, hogy nem érted meg, amit mondok (vagy én nem értem, hogy valójában érted :), vagy bennem, hogy nem mondom el jól, egyik esetben sincs értelme folytatni. Bár próbáltam elmozdulni a holtpontról, hogy az eredeti cikk hibáival foglalkoztam, de valószínűleg ugyanoda jutnánk ismét.
    Ha nem kívánsz válaszolni a következő problémára, megértem, nem kapcsolódik szorosan a témához, eddig is csak megemlítettük.
    “A romlandóságnak való alávetés oka az angyalvilág és az ember lázadása. A rák a teremtett világ romlandóságának egyik megnyilvánulása.”
    Hogyan találhattak tumorokat dinoszauruszokban és egyéb őshüllőkben, hisz ezek jóval az ember előtt éltek? https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3003131/pdf/neo1212_0957.pdf

    Köszönöm

  • Szabados Ádám says:

    Röviden, mielőtt több napra lelépek a netről:

    1) A romlandóság kapcsán az angyalvilág engedetlenségét is említettem.
    2) A Biblia egyedül az emberrel összefüggésben említi az örök élet lehetőségét.

    Tumorok ezért az ember bukása előtt is lehettek.

  • dzsaszper says:

    Kedves Lima Rui,
    “Érdekes ugyan a DNS kód és a nyelv illetve operációs rendszerek közti hasonlóság, de épp elég különbség is adódik ahhoz, hogy ne azok függvényében vitatkozzunk a biológiáról vagy evolúcióról.”

    Ezt én nagyon máshogy látom, és nem értem, milyen különbséget látsz például egy programozási nyelv és a DNS között, egy programozási nyelv fordítóprogramja és alatta futó hardver és mondjuk a fehérjeszintézis között, ami indokolná, hogy figyelmen kívül hagyjuk ezt az aspektust?

    Azt visszautasítom, hogy a programozási nyelvet a fehérjeszintézis nyelvére hasonlatként használtam volna. Lehetnek hasonlatok, repülőgép, célratartó rakéta, lándzsa, ezek valóban hasonlatok.
    A DNS kapcsán azt gondolom hogy a DNS-ek nyelve ténylegesen egy programozási nyelv. Nem csak hasonlítható hozzá, nem metafora, hanem igazi programozási nyelv.

    Ami a memetikát illeti, érdekes felvetés, még az is lehet hogy tudományág lesz belőle, de egyelőre nagyon nem látszik, hogy ha tudomány is, milyen. Legtöbb közét a bölcsészethez, filológiához látom.
    A nyelvészet is valahonnan innen indult, de jött Noam Chomsky… és azóta egy kicsit más a helyzet 🙂
    Lehet hogy a memetikának is szüksége lenne a maga Noam Chomskyjára, és utána máshogy gondolnám én is.

    Elnézést kérek az elgépelésért az miRNS kapcsán.

    Amit a polimerázok kapcsán írsz, azt a CD lemez kapcsán is el lehetne játszani, színtiszta fizika az egész, köze nincs a számítógéphez, amiben a CD-író benne van… A kulcs a Polányi-féle kettős meghatározottság itt is. Megkerülhetetlen a téma.

    “Ezek az utasítások mind-mind kémia.”
    Itt egy igen fontos különbségtételt mulasztasz el.
    Az utasítás végrehajtása maga a kémia. Az utasítás nem kémia, az utasítás vezérli a kémiai folyamatokat.

    Amíg téged az optika érdekel a CD lemezen, és nem érdekel, hogy a kódolás mit kódol, és nem érdekel a számítógép a CD-író mögött, addig hiába magyarázom neked, hogy a CD lemez tartalmát a fizika törvényei szerint írták oda, de az információtartalom más szinten lett meghatározva…

    Remélem érted e legutolsó hasonlatot 🙂

  • Lima Rui says:

    Kedves dzsaszper!

    Örülök, hogy végre kezd tisztázódni a kép, mert már zavaró volt ez a nagy egy helyben topogás.
    “Az utasítás végrehajtása maga a kémia. Az utasítás nem kémia, az utasítás vezérli a kémiai folyamatokat.”
    De, szerintem az utasítás is kémia, ezt próbáltam fejtegetni az előző pár millió karakterben. De ha már tudom, hogy szerinted nem kémia, arra is kíváncsi lennék, hogy akkor szerinted mi? Azon kívül, hogy információ. Hogy tiszta legyen a kép, esetleg lehet konkrét példa is, egy konkrét fehérje.
    (Majd még válaszolok részletesebben is.)

  • Lima Rui says:

    Hisz az, hogy valami “információ” nem zárja ki, hogy egyben “kémia” is legyen. Hisz a világon minden információ.

  • dzsaszper says:

    Az utasítás is kémia szinten van kódolva, de ettől még az utasítás nem egy kémiai fogalom.
    Az utasítás, amit a főnök ír emailben, hogy menj be egy órával korábban, persze bitek formájában érkezik, de ettől még az utasítás nem elektrodinamika, csak elektrodinamkiai módon van kódolva.

  • Lima Rui says:

    1) Tudom, itt a kódról van szó, nem az információhordozóról, de az azért fontos különbség, hogy a DNS kód, a fehérjék, az élőlények minden alkotóeleme vagy egy korábbi, ekvivalens verziójuk spontán létrejöhet, abiotikus úton, míg a repülő, rakéta, CD, az összes általatok felhozott példa nem, vagy egyes alkotórészeik nem, az üzemanyaguk nem, vagy maga az energiatermelő reakció, ami hajtja, az nem jöhetne létre, sőt, le sem játszódhatna élő szervezetben.
    2) Az emailes példa felháborítóan gyenge, mutatja, hogy hiába erőlködtem ebben a 140 hozzászólásos vitában. Ha hasonlat, akkor legyen a gravitáció. A bolygó utasítja a közel kerülő meteort, űrhajót, hogy zuhanjon le, hogy vonzza a bolygó tömegközéppontja. A gravitációs kölcsönhatás egy utasítás, az információt a téridőgörbület (vagy a hipotetikus gravitonok) hordozzák. De nem választható szét a kettő, a téridő görbület, a gravitációs mező az egy és egyben maga az utasítás. A molekulák világa is az alapvető kölcsönhatásokon nyugszik és a fehérjék molekulák. Az email bitjei bármit kódolhatnának, bármilyen nyelven, a logikai kapukat bárhogy fel lehetne állítani, stb. A gravitáció a tömeg függvénye, nagy tömeg az nagy gravitáció, nagy téridő torzulás. Nem számít, hogy milyen atomok halmaza adja a tömeget, csak az atomok mennyisége számít, a téridő görbülete magában hordozza ugyanazt az utasítást, mindig. A kettő ugyanaz, az utasítás és ami hordozza azt nem választható szét.
    3) A promóter nem csak azt szabja meg, hogy a fehérje hol és mikor expresszáljon, hanem azt is, hogy egyáltalán hol van a gén. Valójában ez az elsődleges szerepe. A promóter szabja meg, hogy hol kezdődjön az mRNS, melynek az első ATG-je (az érett mRNS-nek eukariótáknál) szabja meg a fehérje első aminosavát. Promóterek nélkül, melyek valójában polimeráz kötőhelyek, a teljes genom értelmetlen. A polimeráz kémiai úton írja át a DNS-t RNS-é, a tRNS-riboszóma komplex kémiai úton alkotja meg a fehérjét. Egyik sem értelmezi, az enzimek bármit átírnak, ha a mintán rajta van a megfelelő kémiai, fizikai szignál. Ez csupán bázispárosodás, kémiai kapcsolatok. A fehérje aminosav sorrendje (ami benne van a DNS-ben) és az aminosavak karakterisztikája (nincs benne a DNS-ben) együttesen adja meg a fehérje struktúráját, amiből következik a fehérje funkciója. A DNS egy hosszú betűsor, mely ugyan tartalmazza a fehérjék elsődleges szerkezetéhez szükséges információt, ami a gén, de értelmezhetetlen formában. Az értelmezés első lépcsőfoka a promóter. Ezért nem is ment sokra a humán genom program, amelyik a promóter szekvenciák és ATG-k alapján megtalálta a 20 ezer gént, de ez önmagában nem sokat ér. Nem kell mRNS és tRNS-riboszóma komplex az embernek ahhoz, hogy a DNS kódot lefordítsa fehérjévé (már nem kell, hisz lemodelleztük, tudjuk a kód-kodon párosítást, stb), de ez önmagában nem mond sokat a funkcióról, azt esetleg prediktálni lehet, de azt is más, hasonló fehérjék alapján. Mindez azért fontos, hogy lássátok, a promóter funkciója benne van a kémiai szerkezetében, a kettő nem választható el, ahogy a gravitációnál sem. Valószínűleg az első protosejteknek, genetikai elemeknek nem volt promótere, ahogy a mai RNS vírusoknak (nem retrovírus!) sincs. Azért emelem ki mégis a promótert, mert itt egy fizikai létezőben van benne a kémiai szerkezet és az abból adódó funkció. A promóterhez kötődő polimeráz számára a promóter után következő gén nem hordoz semmiféle információt, számára nincs értelme, csak bázispárosítja hozzá az RNS-t. És így tovább, a fehérje a funkcióját csak a harmadlagos (negyedleges) szerkezettel éri el. A DNS az elsődleges szerkezetet kódolja.
    Kieg: dzsaszper: Jól gondolom, hogy az ID felé hajlasz, Ha igen, akkor olyankor mit szólsz, amikor pl azt hallod, hogy valaki a tumor teológiai magyarázataként az angyalok és emberek lázadását veszi? Bár tudom, ez nem tartozik az evo témához.
    Ezeket az angyalokat Occam borotvája vígan levágja. Bár ha valakinek az angyalok lázadása olyan valós, mint pl Mátyás király? Vagy én? Nyilván akkor nem vágja le őket a borotva. Csak mennyire valósak az angyalok? Vagy mi van azzal, aki valósnak veszi őket, konkrét létezőnek?

  • dzsaszper says:

    Kedves Lima Rui,

    1)
    “az azért fontos különbség, hogy a DNS kód, a fehérjék, az élőlények minden alkotóeleme vagy egy korábbi, ekvivalens verziójuk spontán létrejöhet, abiotikus úton, míg a repülő, rakéta, CD, az összes általatok felhozott példa nem”

    Itt egy feltételezést kezelsz tényként, és épp ez a vita tárgya…
    Nem tudom, mit értesz abiotikus út alatt, csak tippelni tudok, hogy az Ádám által említett módszertani materializmust.

    Innentől kezdve persze könnyű bármit is bizonyítani amit eleve axiómaként feltettünk… Mi történik, ha elvesszük az a priori feltételezést, és megengedünk, ha nem is feltétlenül egy Teremtő Istent, de mondjuk minimum egy Crick féle pánspermia-elméletet?
    Milyen érvek vannak az a priori feltételezésen kívül az abiotikus létrejövetel mellett?
    Erről szól az egész vita.

    2) lehet hogy az e-mailes hasonlat gyenge, de a gravitációs hasonlat még sokkal gyengébb, a gravitációs hasonlat épp egy nagyon lényeges ponton sántít.
    A bolygó nem utasít, hanem vonz és kész. Nincs ki jól vagy rosszul értelmezzen bármiféle utasítást, nincs semmiféle kontextust.
    A DNS önmagában, kontextus nélkül nem hoz létre az égvilágon semmiféle fehérjét. Kell neki az a környezet, ami végrehajtja az utasításait, mint a pendrive-odon lévő emailinek részben a számítógép USB porttal és operációs rendszerrel, részben te aki el tudod olvasni az emailt… a DNS környezete nyilván a sejt vagy prokarióta élőlény, aki értelmezni tudja a DNS-t, és a DNS a fehérjeszintézisre csak ezen az értelmező környezeten keresztül van hatással. Ld. angolul pl. http://www.asa3.org/ASA/PSCF/1970/JASA12-70Polanyi.html

    3) “A DNS egy hosszú betűsor, mely ugyan tartalmazza a fehérjék elsődleges szerkezetéhez szükséges információt, ami a gén, de értelmezhetetlen formában. Az értelmezés első lépcsőfoka a promóter”
    Dehogyis! A promóter a kód része.
    Persze promóter nélkül a kód többi része értelmezhetetlen, mint egy XML vagy HTML dokumentum a karakterek nélkül.
    Az értelmetés első lépcsőfokat tehát legalábbis a promóterek _értelmezése_.
    A DNS tartalmazza a promótereket, tehát a megfelelő kontextusban, a megfelelő értelmező által értelmezhető, ha nem lenne értelmezhető, nem élnénk.

    “Mindez azért fontos, hogy lássátok, a promóter funkciója benne van a kémiai szerkezetében, a kettő nem választható el, ahogy a gravitációnál sem.”
    A promóter funkciója elősorban nem a DNS kód kémiai szerkezetében, hanem a DNS-értelmező kémiai szerkezetében keresendő, ami ügyes fizikai-kémiai trükkel épp a promótert keresi. Ha nincs értelmező, továbbra sincs a DNS által kódolt fehérje szintézise. Felőlem belemehetünk a trükkbe, hogy a merevlemezen vagy a CD-n a fájlrendszer leírói nélkül nem tudod értelmezni a lemezt… Ha nem neodarwinistával vitáznék, akkor azt mondanám a promóter és a biológiai promóter-értelmezés kapcsán, hogy a tervező mérnök nagyon ügyes volt ér értette a dolgát 🙂

  • dzsaszper says:

    az XML és HTML dokumentumok kapcsán az < és > karakterekre gondoltam, csak ahogy leírtam őket, az a blogmotor számára nem volt emészthető…

  • Lima Rui says:

    1) Nem zárom ki a pánspermiát, sőt. De te talán azt állítod, hogy abiogenezis elképzelhető máshol, csak a Földön nem? Vagy már élő sejtek, spórák kerültek volna ide? Mert ha az élet eredetét keressük, abban a pánspermia max annyit segít, hogy a Földre hogyan került az élet, de a végén ugyanoda jutunk.
    Ezekről az abiotikus módon létrejött szerves molekulákról beszélek:
    http://www.nature.com/articles/srep06769 (elsősorban a Figure 4)
    De ez sokkal érdekesebb:
    https://application.wiley-vch.de/books/sample/3527320962_c01.pdf
    Elég itt is a táblázatokat nézni. Gyakorlatilag minden életet alkotó szerves molekulát megtaláltak a Földön kívül.
    2) “A bolygó nem utasít, hanem vonz és kész.” Egy nagy hegynek is vonzhatna, de ha egy bolygón van rajta, akkor az vonz, mert az a nagyobb. Szóval nem olyan egyszerű, mint hiszed. De nem is ez a lényeg. A fehérje is hasít és kész. Beágyazódik a membránba és kész. A DNShez kötődik a polimeráz és kész. Az egyszálú DNS kétszálúvá válik stabilitási okokból és kész. Persze, hogy a rendszer, a közeg (a sejt) az egész jóval bonyolultabb, mint hogy a bolygó vonz és kész, ezért se találunk az űr minden szegletében életet, de gravitációt igen. Attól még az alapja a kémia és fizika (és kész 🙂 ).
    3) “Az értelmetés első lépcsőfokat tehát legalábbis a promóterek _értelmezése_.” Igen, ahogy kötődik hozzá a polimeráz. Kémiai úton és lemásolja a DNS-t és kész. “A promóter funkciója elősorban nem a DNS kód kémiai szerkezetében, hanem a DNS-értelmező kémiai szerkezetében keresendő, ami ügyes fizikai-kémiai trükkel épp a promótert keresi. ” Persze, mindezek specifitásához a fehérje és a célpont megfelelő szerkezete is szükséges. Fizika és kémia az a bizonyos értelmezés. A polimeráz konzervált struktúrákhoz kötődik a promóter régiókban. Van különbség a baktériumokban, archaeákban, eukariótákban, de igen konzervált, nagy az egyezés, csoportokon belül, stb, a végén közös leszármazásra gyanakodnánk. Sok enzim olyan reakciót gyorsít fel, ami magától is végbemenne, pl a bázispárosodás.
    http://phys.org/news/2016-11-life-biomolecule-self-replicated.html
    http://cen.acs.org/articles/94/i18/first-nucleotides-might-formed-Earth.html
    Valószínű, hogy az első protoélőlényekben nem volt promóter, de lehet, hogy polimeráz sem, hacsaknem maga a ribozim nem rendelkezett ezzel a funkcióval.

    És itt van még egy kis tudomány. Remélem lesz időm nekem is alaposan elolvasni ezeket.
    https://www.ncbi.nlm.nih.gov/books/NBK6360/
    http://europepmc.org/articles/PMC4848480;jsessionid=3q0GZ6kDrf9YV2ya3ekf.1
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3331698/
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4390850/

  • Lima Rui says:

    dzsaszper: Ádámról, mivel az ő blogja és bemutatkozik, tudom kicsoda, mivel foglalkozik. Megtudhatom, hogy te ki vagy? Mivel foglalkozol?

  • Veszt says:

    Sziasztok!

    Lima Rui:
    Hatalmas energiát fektettél bele hogy leírd azt ami mindenki számára nyilvánvaló, hogy egy anyagi világ anyagból épül fel és persze hogy a kvarkok atomokat, az atomok fehérjéket és a fehérjék élőlényeket alkotnak. Hatalmas munka volt de ezzel nem igazoltál semmit, legalábbis azt biztos nem amit szerettél volna.

    A vita tárgya nem az volt, hogy az anyagi világ anyagból épül-e fel, hanem hogy az élet és annak alapjai a DNS, RNS, fehérjék létrejötte igazolható-e a véletlennel. Remélem ez az egyszerű hozzászólás helyre tud rakni, hogy a problémáról beszélj és ne írd le még többször azt amit senki se vitat.

    Senki se vitatta, hogy a DNS-t vagy a fehérjéket nem atomok alkotják és azokra ne a kémia és fizika törvényei vonatkoznának a kérdés a struktúra létrejötte, de ahogy látod és amibe te is belefutottál az az, hogy erről pár elméleten kívül semmi tudományos érv és bizonyíték nincs. Maradnak a milliárd évek és a véletlen, bizonyítatlanul.

    Ádám és dzsaszper és én is amellett szólunk, hogy a milliárd évek és a végtelen nem hozhat létre ilyet, több okból sem: a rendszer bonyolultsága és a termodinamikai törvények miatt. Nagyon becsülendő a kitartásod és a belefektetett munkád de a lényeget nem értetted meg, remélem most kicsit jobban érted, hogy mi a probléma. Persze az is lehet érv a részedről, hogy a kérésünk nem teljesíthető, mert milliárd évek és véletlen az kell… de akkor be kell látni, hogy a tudomány nem tudja igazolni azt amit állít.

  • Lima Rui says:

    Veszt: Valóban sok munka van benne, bár, hogy a doktorimra nem tudok ennyire fókuszálni 🙂 De ez nem a ti hibátok.
    Részben igazad van, de azért pontosítanék. Tisztában vagyok vele, hogy az abiogenezissel kapcsolatban nagyon sok még a folt és én se tudok olyat mondani, amit ne hallottatok volna. Az abiogenezis kemény téma, nem is vagyok járatos benne, de ettől függetlenül evolúció még lehetne, hisz az az élőlények fejlődése. Mivel egy felsőbbrendű teremtő intelligencia tetteinek mozgatórugóit fel nem foghatjuk, próbáltam rávilágítani a DNS kódban lévő tervezési hibákra, melyet nem kéne elkövetnie egy intelligenciának (pszeudogének, a genom 44%-nyi nem expresszáló transzpozon része, hogy a hibajavítást miért nem jobb, stb), de persze nem kaptam értékelhető választ. Szerintem a tanulmány is, amiről a cikk, elég béna, sok pontra rávilágítottam. A beszélgetés aztán elkanyarodott egy irányba, ami annyira nem is fontos és ebbe eléggé beleragadtunk. Az utóbbi hozzászólásokban amellett próbálok érvelni, hogy az élet és a kódrendszere mennyiben más, mint a nyelv vagy ember alkotta kódok, ezért hiba összehasonlítani ezeket.
    dzsaszper: A nyelvet, az írást, a szavakat az agy értelmezi, tanult folyamatok révén. A különböző emberi agyak kb egyformák, egyéni különbségek vannak, de az nem függ össze azzal, hogy melyik agy milyen nyelvet tud értelmezni, akár többet is. Ez a tanulástól függ. Csimpánz és gorilla agyak is tudnak értelmezni emberi nyelveket. (Emiatt vagy ettől függetlenül, a csimpánz és gorilla kommunikáció nyelvnek számít? Mi a választóvonal nyelv és kommunikáció közt? Tényleg érdekel.) A nyelvnek van egyfajta evolúciója, vagy fejlődése, de a rá ható szelekció teljesen más természetű. Egy nyelv nem azért hal ki, mert nem tudja végrehajtani a funkcióját, hanem mert kihal az a csoport, amelyik használja. Az angol nyelv világhódítása se azért történt meg, mert jobb lenne, alkalmasabb a többinél, történelmi és gyakorlati okai vannak. A gének viszont egyértelmű kapcsolatban állnak a fehérjével, egymásnak megfeleltethetőek. Ha torzul a gén, torzul a fehérje is, nem látja el megfelelően a funkcióját, az azt hordozó egyed elpusztul. A szelekció direktben visszahat a kódra. A DNS kódot végső soron a tRNS értelmezi, a tRNS az agy. De a tRNS kémiai okok miatt köti meg a tripletet és kémiai okok miatt rendeli hozzá a megfelelő aminosavat. Ez determinált, így alakult. Ha módosul a tRNS, akkor ugyanahhoz a triplethez más aminosavat rendel (vagy fordítva). Az agynak ez tanulás révén valósul meg. A CD olvasó is a fizikai törvényeknek megfelelően olvassa le az adatokat, de amit az adatok hordoznak azt az ember választja ki, szelektálja, bármi lehet, nincs összefüggésben se a kód fizikai valójával, se a bitekkel, se a CD-vel, se a leolvasóval, csupán az emberi elmével. Az agyi kapcsolat szubjektív, a biológiai objektív, akárcsak a többi kapcsolat a fizikai és kémiai világban. A DNS kód annyira nyelv, mint ahogy az elektronok kódolják az atom fizikai tulajdonságait. Persze, bonyolultabb annál, ha nem lenne, akkor nem is lenne ez a vita.

  • Lima Rui says:

    Valójában egy olyan témában vitatkozunk, amelyikhez egyikünk se ért igazán. És mind tudjuk, hogy nem is fogjuk tudni meggyőzni a másikat. Igaz, a valóban hozzáértők, illetve a releváns tudósok 98%-a mellettem áll, de ez nem jelenti azt, hogy igazunk van. És tény, hogy vannak homályos foltok. Akár nem tudományos elemei is vannak a tudományos evolúciós elméletnek, pl mondhatnánk ezt is, mondják is egyesek: mivel a teremtést, a genezist kizárhatjuk, nem marad más, mint az abiogenezis. Nem túl elegáns, de a kizárásos módszer szükségszerűségből alkalmazható. És tudományos értelemben a teremtés tényleg kizárható, míg az abiogenezis, még a ti értelmezésetekben is, valószínűtlen, de matematikailag lehetséges. A Teremtő, bármilyen természetű is, olyan bonyolultságú lény, hogy nem jöhetett létre az univerzumunk törvényei szerint, ha a földi élet se lehetséges, így vagy öröktől fogva létezik vagy más univerzumból származik vagy olyan létező, melyről tudomásunk sincs (pl sötét anyag lehetne, amit sejtünk egyáltalán, de ilyen erővel bármi). Ezekkel igazából a tudomány nem tud mit kezdeni, mellesleg Occam borotvája is levágja, hisz ezeknél jóval több a bizonytalansági és valószínűtlenségi faktor, mint az abiogenezisnél. Jöhetne az ID-s magyarázat, hogy ez a kérdés túlmutat a megismerhetőség határán, így nem kell vele foglalkozni. Rengeteg biológus nem is foglalkozik. Ettől még evolúció van, rengeteg bizonyíték van rá, hogy a fajok egymásból alakultak ki. Ennek az alternatívája az, hogy a fajokat egymásból alakították ki, és így visszakanyarodunk az előző kérdéshez. Az ID valójában nem alternatíva, nem mutatnak fel semmit, persze hogy nem kutatnak olyat, ami szerintük nem létezik. Ennek ellenére mégis ezzel a kérdéssel foglalkoznak. Trollok. A megoldás az, hogy a biológusok keresik az abiogenezis bizonyítékait és erősítik az evolúcióét, míg a többiek keresik a Teremtőt és vagy be próbálják bizonyítani a létét a többiek számára, vagy mivel nem tudják, inkább hagyják a kérdést. A hit nem tudományos kérdés, így nem is mérhető annak mércéjével. Ettől egy hívő rámutathat a tudomány hibáira, vagy igaza van, vagy nincs. De ha az alternatívákat nézzük, akkor tudományos értelemben nincs mit felmutatni az abiogenezis és evolúció ellenében.

  • Lima Rui says:

    Kihagytam a Teremtő eredetével kapcsolatban (öröktől fogva létezik, más univerzum, vagy egy nem ismert erő, forrás), hogy ez utóbbi akár az evolúcióra és abiogenezisre is lehet magyarázat. Hogy nem ismerünk mindent. És ez biztos igaz az ősi Föld körülményeire. De akár az is lehetne, hogy a sötét anyag lehel életet a molekulákba. De ez már hit. Viszont ugyanannyi rá a bizonyíték, mint a többi Teremtőre. Hacsaknem számít a Szent Könyv bizonyítéknak. Abból viszont rengeteg különféle van, a legtöbb egymásnak ellentmond. De ez már más téma. Vagy mégsem, ha a Teremtés alternatívája az abiogenezisnek. És az abiogenezis még mindig valószínűbb, mint a kismillió vallás bármelyik forgatókönyve. Legalábbis több rá a bizonyíték és Occam is mellette szól.
    Az a biztos, hogy élünk… Biztos ez? … Stb

  • Lima Rui says:

    A hit koordináta rendszerében, a hit értelmezési tartományában az evolúciós elmélet egyenrangú bármelyik hittel, vallással. A tudomány koordináta rendszerében, a tudomány értelmezési tartományában az evolúciós elmélet mérhetetlenül jobban bizonyított bármelyik hitnél, vallásnál.

  • Veszt says:

    “az az élőlények fejlődése” – Szerintem pont itt van az egyik nagy Achilles-ínszalagja az evolúció elméletnek fejlődésről beszél holott a korrekt kifejezés az lenne hogy alkalmazkodás, ami nem feltétlenül kellene hogy járjon bonyolódással. De ezt gondolom te is tudod, de éppen itt van egy olyan buktató amit szeretnek figyelmen kívül hagyni, hogyha tényleg egy irányítatlan anyagi folyamat hozná létre az élőlényeket annak nem a jelenlegi irányba kellene futnia, mert sem a szaporodást, sem a biokémiai utak, szabályozások nem a legoptimálisabbak ami várható lenne egy “élsz vagy meghalsz” rendezőelv alapján. Tehát ha te tervezési hibákról beszélsz a Teremtő esetében, az evolúció esetében is sok ilyen terület fedezhető fel ahol nem érvényesül a “szelekció”. És ez az amiről beszélt Ádám is, hogy egyre többen vonják kétségbe azt az evolúciós elméletet mi jelenleg elfogadott, túlságosan sok kétség merül fel vele kapcsolatban.

    A tervezési hibák felvetésével kapcsolatos felvetéseid üresek és megalapozatlanok. Te is jól tudod hogy az általad hibáknak feltételezett dolgok nem is hibák. Ha ismernéd a Bibliát (nem tudom hogy mennyire ismered vagy sem, de a válaszodból az jön le hogy nem igazán) Isten az élővilágot úgy teremtette, hogy szaporodjanak és töltsék be az egész Földet, úgy mond ez egy biológiai törvény ahogy fizikai törvény a gravitáció. Mindkettőt Isten hozta létre és ez az amit te “csak kész” jelzővel félre söpörsz és már lendülsz is tovább, holott itt van valahol a kulcs, hogy az élet miért úgy működik ahogy. A programja, törvénye ha úgy tetszik az az hogy szaporodjon és alkalmazkodjon, hogy be tudja népesíteni a Földet. Ebben az az érdekes, hogy ezt már 2-3000 évvel ezelőtt leírták, mert Isten ezt kijelentette. És nem ez az egyetlen dolog ami a Bibliából megismerhető. Isten az élőlényeket felruházta az alkalmazkodás képességével ami elkerülhetetlen kapcsolatban áll a DNS-RNS-fehérje működési rendszerrel, és ebbe szépen beilleszkedik a transzpozon rendszer, a látszólag hibás másolási rendszer. Sem az ID sem a konzervatívabb teremtés elméletek nem tagadják az élőlényeg genetikai variabilitását és az abból eredő fenotípus variabilitást, azt vonják kétségbe, hogy törzsfejlődés lenne: ez az úgy nevezet baraminológia. És ez az a terület amire az evolúció párti tudósok se tudnak bizonyítékot hozni. Amit te evolúció melletti bizonyítéknak tartasz az egyszerűen a fajon belüli variabilitás felmutatása és semmi köze nincs a fajok egymásba alakulásának vagy új fajok létrejöttének. Ebbe a kérdéskörbe pedig jól illeszkedik a konzervatív fehérjék kérdése is. Mert ez magyarázható a teremtéssel is és nem csak kizárólagosan az evolúcióval.

    Nyelv és DNS-RNS-Fehérje rendszer: itt nem látod a fától az erdőt. Azt mondod a nyelv az asszociáció és ott nincs meg a kémiai-fizikai determináltság… Miért miért ne lenne meg? Atomi, molekuláris, fehérje szinten jel keletkezik ami manifesztálódik (pl. hangszalagon keresztül levegő rezgés), majd ezt egy érzékelő rendszer szintén fehérje, molekuláris és atomi szinten választ hoz létre. Amit te asszociációnak nevezel semmiben nem különbözik más biológiai folyamattól. Tudom hogy ez a nagy érved, hogy azért nem nyelv a DNS-RNS-Fehérje kapcsolat mert a nyelvben asszociáció van, de elfelejted, hogy az is kémiai-fizikai determináltság vezeti ahogy a DN-RNS-Fehérje rendszert. Egy nyelvi rendszer attól nyelv, hogy van információ és jelentés és a kettő között információ feldolgozó egység ami a jelentést létrehozza. Ez meg van a nyelvben és az élőlényekben is. Sose értettem, hogy ezt miért nehéz elfogadni. Ott hibáztál mikor azt mondod hogy a nyelv az más természetű mint az élőlények. Miért is? Azt mondod más féle szelekció hat rá? Miért másféle a szelekció? Ugyan olyan szelekció hat rá mint az élőlényekre, ha olyan tulajdonságokkal bír ami a kedvez a túlélésnek akkor fent marad. Pl. a kék szemszín (angol) párosul a nagy izomerővel (gazdasági helyzet) akkor a populációban az lesz az erős (elterjed a világon). Az élővilágban is sok olyan tulajdonság van ami más tulajdonságok térnyerése miatt nyernek teret. A kémiai-fizikai determináltság ami az érvelésednek a sarokköve elenyészik, mivel minden de minden a kémiai és fizikai determináltságnak van alávetve ezen a létsíkon. Nem tudsz mondani semmit ami nem így működne. Ez gyenge érv arra, hogy a DNS-RNS-Fehérje rendszer ne egy nyelv lenne, mert minden olyan tulajdonsággal rendelkezik amivel egy nyelvnek rendelkeznie kell és nem a kémiai determináltság miatt nem nyelv. Ezt maga a biológiai tudomány elismeri mikor létrejött a bioinformatika tudománya, ez a tudomány ág éppen a rendszer nyelvi tulajdonságait használja hogy új ismeretekhez jusson és a nyelvészet eszközeit használja.

    Az utolsó bejegyzésed ahol érvelsz az abiogenezis mellett pedig megalapozatlan. Írod hogy több az abiogenezis melletti bizonyíték: nincs semmilyen bizonyíték az abiogenezis mellett, egyedül szerinted valószínűbb csak, alátámasztani nem tudod. A jelenlegi ismereteink szerint az a legbizonyítottabb, hogy a termodinamika törvényei szerint az élet nem jöhetett létre. Akkor mi is a valószínű? Sajnos ahogy te is leírtad a jelenlegi tudós társadalom nem akar kilépni a abiogenezis és evolúció köréből. A mi feladatunk tudósként, kutatóként, hogy ne kössük meg az agyunkat, merjünk szabadon és ésszerűen gondolkodni még akkor is ha az ellene megy a mainstreammel. Persze te mondhatod, hogy ha nincs más akkor érjük be ezzel; én nem érhetem be ezzel, mert pont így zárom el magam az új megismerésétől, és ahogy eddig más kutatók, felfedezők életét is láttam: akik igazán sikeresek voltak azok se érték be ezzel. Merni kell túllépni a tudományos dogmákon, pláne azokon amik nem megalapozottak és csak azért léteznek mert nincs jobb, nincs más.

  • dzsaszper says:

    Kedves Lima Rui,

    kicsit zanzásítva válaszolok egy sor kommentedre 🙂

    kérdezted, mivel foglakozom… programtervező-matematikus a végzettségem, és szoftverrel foglalkozom, a munkám során kicsit mással, de hobbi szinten fordítóprogramokkal, és sok programozási nyelvet láttam, sőt volt hogy egypárat oktattam (ami itt érdekes lehet, assembly nyelvet is).

    1) Nem zárom ki a pánspermiát, sőt. De te talán azt állítod, hogy abiogenezis elképzelhető máshol, csak a Földön nem? Vagy már élő sejtek, spórák kerültek volna ide? Mert ha az élet eredetét keressük, abban a pánspermia max annyit segít, hogy a Földre hogyan került az élet, de a végén ugyanoda jutunk.

    Nem állítom, hogy az abiogenezis elképzelhető vagy elképzelhetetlen lenne máshol. Azt állítom, hogy ez kívül esik a természettudomány hatáskörén, és innentől kezdve az egyébként eredetileg tudományos elméletek extrapolációja is kívül esik. Az extrapoláción alapuló spekuláció legfeljebb science fiction, de már nem tudomány. Aki az eredetkutatás, kezdeti filogenezis, abiogenezis mezejére lép, elhagyja a klasszikus értelemben vett természettudományt, és innentől kicsit más eszköztárral kell dolgozzon (pl. a sokat emlegetett Occam borotvája innen nem játszik, mert a dolog az igazságügyi szakértéshez áll legközelebb. Képzelj el egy közlekedési balesetet, a vádlott azt állítja hogy egy szembejövő elvakította, de Occam borotvája miatt nem veszik figyelembe, és kimondja a bíróság hogy nem volt ott szembejövő jármű…)
    Itt reagálnék az utolsó kommentedre: az evolúciós elmélet legfeljebbb addig bizonyított jobban, amíg nem lépett ki a tudomány hatásköréből. Onnan a sci-fi vagy a hit kategóriájába esik bizony az evolúció is.

    2) “A bolygó nem utasít, hanem vonz és kész.” Egy nagy hegynek is vonzhatna, de ha egy bolygón van rajta, akkor az vonz, mert az a nagyobb. Szóval nem olyan egyszerű, mint hiszed.
    A hegy is vonz, csak épp oly csekély mértékben, hogy lényegében elhanyagolható. Igen, tényleg ilyen egyszerű. A tömegvonzás két tömeget feltételez és semmi mást.

    A fehérje is hasít és kész. Beágyazódik a membránba és kész. A DNShez kötődik a polimeráz és kész. Az egyszálú DNS kétszálúvá válik stabilitási okokból és kész. Persze, hogy a rendszer, a közeg (a sejt) az egész jóval bonyolultabb, mint hogy a bolygó vonz és kész, ezért se találunk az űr minden szegletében életet, de gravitációt igen. Attól még az alapja a kémia és fizika (és kész 🙂 ).

    Persze, az autó is gurul és kész, és annak az alapja is a kémia és a fizika… ja meg persze nem kevés mérnöki munka 🙂
    Ahhoz, hogy a DNS alapján fehérje készüljön, egy jól egymáshoz illeszkedő rendszerre van szükség. Mint hogy a CD lemezből olvasható email is legyen… vagy hogy az autó guruljon… A gravitációhoz ilyesmi nem kell, csak két tömeggel rendelkező test, köszöni szépen…

    3) éppen ezért a DNS értelmező amely a polimerázt megfelelő környezetben alkalmazza, olyan bonyolultságú ami legalábbis felveti a mérnöki tervezettséget. Azt nem mondtam, hogy a mérnök ember lenne, Isten lenne, vagy valami földönkívüli faj egyede, mert tudományos vitát szeretnék folytatni 🙂 és a DNS értelmezővel még elég messze vagyunk még egy prokariótától is…

    Csimpánz és gorilla agyak is tudnak értelmezni emberi nyelveket. (Emiatt vagy ettől függetlenül, a csimpánz és gorilla kommunikáció nyelvnek számít? Mi a választóvonal nyelv és kommunikáció közt? Tényleg érdekel.)
    Persye hogy nyelvnek számít az emberszabásuak jelrendszere is. A 3 hosszú kockadobás-sorozatok is egy nyelvet alkotnak, ahogy a PIN kódok is. Ez utóbbiak érdektelenül egyszerű nyelvet alkotnak, míg mondjuk a szépirodalommal bíró természetes emberi nyelvek elég bonyolultat — olvastál már Eszterházy Pétert? a magyar nyelvből olykor saját nyelvet épít.

    A CD olvasó is a fizikai törvényeknek megfelelően olvassa le az adatokat, de amit az adatok hordoznak azt az ember választja ki, szelektálja, bármi lehet, nincs összefüggésben se a kód fizikai valójával, se a bitekkel, se a CD-vel, se a leolvasóval, csupán az emberi elmével.
    Itt nagyon tévedsz, az emberi elme már szavakat értelmez, a szavakat pedig az értelmező környezet (számítógép CD olvasóval) a kód fizikai valójának, a biteknek az értelmezéséből nyeri.

    Ami a nyelveket illeti, a bonyolultságuk és kifejezőerejük igencsak lényeges. Ha ez a témakör érdekel, akkor javaslom, a Noam Chomsky féle nyelvosztályoknak, a kis és nagy Bar-Hillel lemmának, a Myhill-Nerode tételnek, Turing gépeknek és a Turing-teljesség témakörnek, esetleg lambda-kalkulusnak érdemes utánajárni.

    A reguláris nyelvek nem túl érdekesek… a környezetfüggetlen nyelvek már kezdenek érdekesek lenni, azzal már egész érdekes szintaktikai szabályokat le lehet írni. De igazán a Turing-teljes nyelvek az érdekesek, igazán érdekes szemantikáról jellemzően a Turing-teljes nyelvek esetében lehet beszélni.

    A DNS mint nyelv bonyolultsága és kifejezőereje legalábbis egy szinten van egy Turing-teljes programozási nyelv bonyolultságával és kifejezőerejével, ráadásul a sejtjeinkben ott a fordítóprogram DNS kódról fehérjékre, sőt, ez a fordítóprogramhoz szükséges fehérjék le vannak kódolva a DNS-ben. Ez olyan, mint a C nyelv fordítója C nyelvben megírva — egy programozási nyelv érettségét szokta mutatni, ha egy nyelv fordítóprogramja a saját nyelvén is elkészül.

    Számomra ez egy igen komoly tudományos érv az abiogenezis lehetetlensége mellett… Programozási nyelvek maguktól nem szoktak az ölünkbe potyogni abiotikus úton 🙂

  • Szabados Ádám says:

    Az egyik legismertebb és nemzetközi szinten is elismert magyar tudományfilozófus – Lakatos Imre – a darwinizmus kapcsán nem csak azt kérdőjelezte meg, hogy tudományosan megalapozott elmélet-e, de azt is, hogy a tudománynak van-e egyáltalán olyan definíciója, amelybe belefér. Ahogy Tom Wolfe írta nemrég, a darwinizmus modern mítosz inkább, amely a naturalizmus térhódításával nyerte el egyeduralkodó szerepét a biológiában. A naturalizmus tartja most is ebben a pozícióban, nem a bizonyítékok.

  • Lima Rui says:

    Veszt: Azért választottam a „fejlődés” szót, mert Darwin is ezt használta (talán). Igen, megfelelőbb az „adaptáció”, bár az alkalmazkodás is értelmezhető egyfajta fejlődésként. Fejlődés egy még inkább túlélő formává. Bár megfigyelhető egy komplexitás-növekedés is, de az inkább következmény. „Legoptimálisabb” szó nem létezik, hasonlóan a „legtökéletesebb”-hez. Amúgy az evolúcióelmélet tovább jutott már Darwinon: van genetikai sodródás is, melyet nem a szelekció határoz meg. A gének nem önmagukban öröklődnek, hanem kromoszómákba rendezve, kapcsoltan. A különböző géneken, szekvenciákon különböző szelekciós nyomás van, ha van egyáltalán, és ez változik is folyamatosan, de egyszerűen megfogalmazva, ha az egyik gén elbukik, bukik vele a genom és az egyed is. És visszafelé is igaz. Persze a génekből sok kópia van, de minden kombináció egyedi, ez az egyed. Az evolúció éppenhogy elbírja a tervezési hibákat, mert meglévő struktúrák, szekvenciák módosulnak, de viszik tovább az „örökségüket”, gyakran akkor is, ha felesleges.
    „Ha ismernéd a Bibliát (nem tudom hogy mennyire ismered vagy sem, de a válaszodból az jön le hogy nem igazán)” Tényleg nem. Egy vallás szent könyvét sem ismerem. Bár a görög mitológiát szeretem.
    „Isten az élőlényeket felruházta az alkalmazkodás képességével ami elkerülhetetlen kapcsolatban áll a DNS-RNS-fehérje működési rendszerrel, és ebbe szépen beilleszkedik a transzpozon rendszer, a látszólag hibás másolási rendszer.” Igen, csakhogy ugyanazok a transzpozonok ugyanott több fajban is jelen vannak. Minél távolabbra mész a törzsfán úgy csökken a közös transzpozonok száma és helye. Hasonlóan a pszeudogének, vírus és baktérium szekvenciák, de a fehérjéket kódoló szakaszokban is a hasonlóság illetve eltérés a rokonság mértékével együtt nő vag csökken. A madár fogak, az emberszabásúak C-vitamin szintézisért felelős egyik enzimje: mind ugyanott, ugyanúgy, pedig egy gén sokféleképpen elromolhat.
    A hibás másolási rendszert arra hoztam fel érvként, hogy az nem fér meg egy jószándékú Isten-képpel. Ki lehetne iktatni a tumorok jelentős részét, ha a kifejlett egyedben 2 nagyságrenddel pontosabb lenne a hibajavítás, míg az ivarsejteknél, gonádoknál működhetne egy kevésbé pontos, a mutációk kialakulásához. Persze egy nemtörődöm Teremtő ezt nem feltétlenül tartaná fontosnak. Bár az se túl rendes, hogy az angyalok és emberek lázadása miatt az állatok is bűnhődnek, sőt, a gyerekek is, akik biztos nem lázadtak.
    „A jelenlegi ismereteink szerint az a legbizonyítottabb, hogy a termodinamika törvényei szerint az élet nem jöhetett létre.” Remélem nem a második főtételre gondolsz.
    Ádám: Lakatos Imre 40 éve halott, azóta sokat fejlődött a biológia és az evolúció tana is. A Wistar konferencia 50 éve volt. Stephen King író, Paul Davies meg fizikus. Stb.
    dzsaszper: „Nem állítom, hogy az abiogenezis elképzelhető vagy elképzelhetetlen lenne máshol. Azt állítom, hogy ez kívül esik a természettudomány hatáskörén, és innentől kezdve az egyébként eredetileg tudományos elméletek extrapolációja is kívül esik. Az extrapoláción alapuló spekuláció legfeljebb science fiction, de már nem tudomány. „ A bolygók keletkezését se figyelték meg. Figyeltek meg más rendszerekben olyan folyamatokat, melyet bolygókeletkezésnek tudtak be. Ezek is science fiction? A megismerhetőségnek vannak korlátai, a tér és az idő jellemzően ilyen korlátok. Lehet tekinteni ezeket határterületnek, de ha az ember kutatni akarja, akkor néha kénytelen kompromisszumot kötni.
    „Számomra ez egy igen komoly tudományos érv az abiogenezis lehetetlensége mellett… Programozási nyelvek maguktól nem szoktak az ölünkbe potyogni abiotikus úton „
    Ez nem kellett volna a végére. Sok minden nem potyog az ölünkbe, mégis létezik. És honnan tudhatnánk mi minden potyogott 4 milliárd évvel ezelőtt?
    De jöjjön a lényeg, remélem értékelni fogod. És a többiek is:
    Egy csupán 66 nukleotidból álló RNS molekula, egy ribozim, mely 2 komponens összeillesztésével (14 + 52 nt) képes magát megsokszorozni. A másolat is birtokolja ugyanezt a funkciót és 5 perc alatt képes magát megduplázni. És semmire nincs szükség csak a ribozimra, a 2 komponensre, egy pufferolt közegre és állandó hőmérsékletre, 44°C ill 48°C-ra. Ráadásul gyakorlatilag bármeddig képes erre, ameddig megvannak a komponensek. A ribozimet in vitro evolúció során, mesterséges szelekcióval választották ki 10^14 RNS molekula közül. A ribozim mutáns komponenseket is képes összeilleszteni különböző hatásfokkal, és az így létrejött mutáns ribozim is képes magát replikálni. Különböző mutáns komponensek összekeverésével magától létrejött egy olyan mutáns ribozim, melynek habár a saját komponenseit egy kicsit kevésbé hatékonyan illeszti össze, mint az eredeti, de a kevert komponensű közegben már sikeresebb, mint az eredeti. Ez már darwini evolúció: mutáció, szelekció, adaptáció. (Az első cikkben benne van minden. A második ugyanaz, csak továbbfejlesztve, 1 óra helyett már 5 perc alatt duplikálódik a ribozim):
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2652413/pdf/nihms86142.pdf
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3943892/pdf/nihms550544.pdf
    Persze életnek még nem nevezhető, ez csak egy autokatalitikus replikátor, kívánatos lenne, ha az utódokban új funkció is kialakulhatna, de ehhez nem elég nagy mértékű a variancia. Jó lenne, ha más szekvenciát is le tudna másolni. Esetleg nukleotidokból építkezve.
    (Autokatailitikus peptid replikátor, csupán 26, 32 vagy 35 aminosav hosszúak:
    http://ac.els-cdn.com/S1367593104001292/1-s2.0-S1367593104001292-main.pdf?_tid=f641dd86-a28d-11e6-96e8-00000aab0f6b&acdnat=1478264308_c4ee83c0f8f9195d6ff3b500a8de64e3 )
    De örülök, hogy végre itt egy ember, aki esetleg tudna válaszolni a kérdéseimre, amik jóval régebbiek, mint ez a vita. Biztos sok naiv, sőt, hülye kérdés is fog most jönni. Értem én, hogy bit, de azok fizikai, materiális hordozó mik? Ha leütök egy billentyűt, pl a „H”-t, akkor elektronok adják a jelet tovább? Hogy viszi az elektron az 1-et és a 0-át? 0-nál kimarad? Az adatcsomagokat mi értelmezi és hogyan? A logikai kapuk hogy néznek ki? A tranzisztorok mit csinálnak?
    Nézzük a ribozim példáján keresztül. A ribozom összeilleszti az A és a B komponenst, ez a ligálás. Ezt hogy írod le programba? „Illeszd össze a következő két adathalmazt, hogy A után következzen B”. Persze fel kell ismerni A-t és B-t és megfelelően összeilleszteni. És utána, ha összeilleszti, akkor ez is képes leadni ugyanazt a parancsot? Hisz A mondjuk az, hogy: „Illeszd össze a következő két adathalmazt,”, B meg: „hogy A után következzen B”. Persze programnyelvben. Az hogy néz ki? (Ha hosszú, elég egy rövid szakasz is, csak hogy el tudjam képzelni. Milyen karakterek és főleg hány?) Hogy értelmezi a program az adatsort? Honnan tudná, hol ér véget az első és hol a második? A betű/bit a nukleotid, a szó a struktúra, a program az egész ribozim. De a biteket kell értelmeznie valaminek, nem? Egy másik programnak? A nukleotidok megfelelő sorrendje felveszi a térszerkezetet és a kettő együtt végrehajtja a ligálást tehát értelmezi az utasítást, ami által lesz egy új, teljes nukleotid sorrend és térszerkezet, mely azt meg tudja ismételni. Ilyet tud egy számítógépes program? A nukleotidok, a ribóz létre tud jönni magától a természetben, 66 RNS-nukleotid elég könnyen össze tud állni (700 millió év alatt egy Föld bolygónyi területen főleg), így ez a program könnyen létrejöhet és utána elszaporodhat, sőt mutálódhat is. Bitek hogy jönnek létre? És ami értelmezi őket?

  • Szabados Ádám says:

    Lima Rui,

    a brit Royal Society új paradigmát kereső londoni konferenciája pedig pár nap múlva kezdődik. Pl. Denis Noble, a rendszerbiológia atyjának kezdeményezésére. Ott lesz James Shapiro, a Chicagói Egyetem ismert biológusa is, aki szintén ma él, és szintén elveti a neo-darwinista szintézist. És még sokan mások. Nem 40 évvel ezelőtti problémáról beszélünk.

    Amúgy kicsit meglepő számomra, de láthatóan tényleg nem érted, mi a funkcióspecifikus információ. Beleragadtál a saját gondolatodba. A sok technikai részlet, amivel a hozzászólásaidat teleszórod, ezt takarják el. Ezért hagytam abba veled a vitát. Értem, amit írsz, csak a nagy része felesleges és irreleváns, amíg te nem érted, amit én írok.

  • Szabados Ádám says:

    Érdekesnek tartom egyébként, milyen harcos ateista-darwinista tűzfészek jött létre ott a szegedi egyetemen (Deák Péter, Boldogkői Zsolt stb.).:) Számomra ez egy abszurd világnézet (vö. Szörnyű kétely, A materialista hegyeket mozgató hite), de a térítő szenvedély még így is meglep (vö. Miért jobb szeretni a felebarátot, mint megenni?).

  • endi says:

    Lima Rui,
    Az elektronikában többféle módszer van a bitek tárolására. Az így tárolt információ kezelését végzi egy hardver. Illetve maga a tárolás is igényel egy szerkezetet. Például a számítógépben lévő hagyományos (gyors) memória olyan, hogy folyton nagy frekvencián frissíteni kell, mert különben eltűnik. Aztán jópár éve már használunk már olyan memóriát is amit nem kell frissíteni, de ezek lassabbak.
    Az, hogy az információból hogy lesz futó program, megint csak hardver kérdése. Tehát van egy gép, ami felhasználja a tárolt információt, és “virtuális programot” futtat rajta. Azért írom hogy virtuális, mert nevezzük valódi programnak magát a hardvert, hiszen lényegében az is egy program. (Én mindent programnak tartok, a létező fizikai világot is.)
    Lehet mechanikai számítógépet is csinálni, amiben minden mechanikusan műküdik, és régen csináltak is ilyeneket. Természetesen ezek nagyon lassúak. De logikailag TELJESEN ugyanazt csinálták mint a mai, elektronikus számítógépek!

    Szavaidból úgy veszem ki, hogy te a dns működéséhez sok-sok dolgot úgy veszel, mintha azok “önmaguktól” lennének. Az anyag működteti őket. Végül is igaz, csakhogy maga az anyag is program. A természeti törvények a hardver, ami működteti az anyagba írt programot. Persze ez így pongyola megfogalmazás, és félig-meddig igaz csak. Hiszen szerintem minden program és minden információ.

    Einstein egyik munkatársa írta: végül az anyag energiának, az energia pedig információnak bizonyul majd.

    Ha érdekel, még szívesen írok a programok működéséről meg ilyesmikről. 🙂

    Még annyit, hogy a véletlen kérdése súlyosan fontos dolog. Mivel véletlen nem létezik, egy buta áltudományos képzelgés. Ennek ellenére a materialista vallás egyik alapköve. A honlapomon van pár írásom a véletlenről: https://barathendre.wordpress.com

  • Lima Rui says:

    Ádám: Értem, hogy mindent értesz, amit mondok. De azért érdekesnek találod ezt a 66 nt hosszú autokatalitikus ribozimet, ami akár magától is létrejöhetne?
    Nekem nincs közöm a szegedi egyetemhez és nem is itt tanultam. De valóban erősen zajlik itt az emberek felvilágosítása. A 2 általad említett figura mellett itt él és dolgozik a GMO téma 3 fő szószólója is: Dudits Dénes, Venetianer Pál és Györgyei János (csak ez utóbbinak van köze az egyetemhez). Bár itt hallottam Eric C. Barrett előadását is, a másik oldalról, ismered esetleg? http://www.korosi.hu/index.php?lang=hu&m=hirek&f=a-nasa-egykori-munkatarsa-prof.-dr.-eric-barrett-eloadasa–a-korosiben
    https://www.youtube.com/watch?v=t_OsWCNuTZg
    Boldogkői tevékenysége, főleg a homeopátia ellen és még inkább az oltásellenesség ellen, hasznos, még ha a stílusa nem is túl jó.
    endi: Milyen véletlen nem létezik? Ha séta közben elfordulok és épp belátok a szomszéd fürdőszobájába, ahol egy nő zuhanyzik, az nem véletlen? Ha csinos is, akkor még kevésbé véletlen? 🙂 Tegyük fel, hogy statisztikailag igen esélyes az élet létrejötte egy ilyen bolygón több 100 millió év alatt. De hogy épp hol és mikor áll össze ez a protosejt, esetleg hogy miből, az nem véletlen? Mi a véletlen definíciója szerinted?
    Igen, érdekelne a programok működése. Maradjunk az elektronikus számítógépeknél egyelőre, bár a régi mechanikus monstrumok is érdekesek. Konkrétan a bitek fizikai megtestesülése érdekelne. Elektronok viszik? Ha írsz egy programot, akkor azt mi hajtja végre? Mi értelmezi? És hogy kell leírnod hogy az értelmezni tudja? Igen, a hardver az anyagi program, a rajta futó szoftver virtuális. Egy hardveren gyakorlatilag bármilyen szoftver futhat. Az élővilágban nem választható szét, habár a DNS és a fehérje elkülönül térben, de a kapcsolatuk determinált és van visszacsatolás is. De a ribozim példa, az előző hozzászólásomban, sokkal egyértelműbb és az első élőlények ilyenek lehettek, vagy ilyenekből épülhettek fel. Ennél a ribozimnál valójában nincs kód, legalábbis ahogy most értelmeznénk, de van információ: az RNS nukleotidok sorrendje kialakít egy struktúrát, mely kémiailag végrehajt egy faladatot, önmaga lemásolását. De át lehetne írni DNS-be és akkor tekinthetnénk kódnak. De az erről, bázispárosodással íródó RNS kód szempontjából teljesen megegyezne a DNS-el, de ellátná ezt a másoló funkciót is. Ha ez benne lenne egy élőlényben, akkor kódnak tekintenénk, fukcióspecifikus információt hordozna, pedig eredetileg csak egy molekula, mely azt teszi, amit tesz, azért, mert olyan amilyen. Egy ilyen program hogy nézne ki? Mi tárolná a fizikai valóságban, mi hordozná akkor amikor működik? Milyen virtuális környezet kéne a működéséhez? Milyen programnyelvben írnád? Az a nyelv hogy jött létre, mi kell a működéséhez? Ez a program leírva hány darab és hányféle karakterből állna? Érdekelnek a molekuláris számítógépek is. Hogy lehetne a koffein molekulát (vagy bármi más) számítási kapacitásra használni? Vagy egy csillagot? (Persze a jövőben.) Lehetne írni olyan szoftvert, ami közvetlenül hatna az őt hordozó hardverre? Ehhez milyen hardver kéne? Milyen virtuális szelekció hathatna közvetlenül a hardverre? Tehát ha nem az ember válogatja ki a hardvert, amin jól fut a szoftvere. A biológia ilyen hardver, hisz hat szelekció a hardverre és a szoftverre is, nem választható szét a kettő, ráadásul ha az egyik elbukik, bukik vele a másik is. Röviden ennyi. A válaszod után biztos lesz még kérdésem. Valójában elég analfabéta vagyok programozásban, konkrétan csak a szót tudom leírni, gyakorlatban nem lenne időm megtanulni, de elméletben érdekel. Persze a MI témakör is. Evolúciós algoritmusok.

  • endi says:

    Érdekes hogy a véletlenről a saját szemszögedből írsz. De én arról beszélek, hogy “globálisan” nincs véletlen. Mi kis emberek véletlennek láthatunk akármit is, amit nem értünk. De látom nem olvastad el az írásaimat, mert ott pont ilyesmikről írtam.

    Programozás: a biteket bármi jelképezheti. Egy mechanikai számítógép logikailag teljesen ugyanúgy működik, mint egy elektronikus. Sokféle memória van, a legalapvetőbb: https://hu.wikipedia.org/wiki/DRAM – de te is tudod, van pl mechanikus tárolású memória ma is, pl a DVD, ahol a biteket a kis bemélyedések jelzik a DVD felületén.
    Logikailag az a lényeg hogy egy gép le tudja ezeket olvasni és a bit két állapota egyértelműen elkülöníthető legyen.
    Ezután a bitek sorozatával már a programvégrehajtó gép azt kezd amit akar. Pontosabban amilyenre megépítették. 🙂 (Tehát a programvégrehajtó gépet is programozták! Valójában szerintem nem lehet logikailag különbséget tenni adat és program között.)

    Ajánlom olvass utána a Turing gépnek, ami a számítógép (és bármilyen programvégrehajtó mechanimzus) leginkább lecsupaszított formája.

    A dns és a dns másoló gépek is turing gépek, csak éppen jóval komplexebbek, nyiván mert másféle “hardver” környezetben futnak.

  • Szabados Ádám says:

    Lima Rui,

    ismerem a ribozimra épülő irányított evolúciós kísérleteket. Érdekesek, csak van egy alapvető probléma velük, ha az élet eredetének magyarázataként akarjuk felhasználni őket. Az alapvető és nyilvánvaló probléma az, hogy a szelekciót ezekben a kísérletekben maguk a mérnökök végzik. Hogy ez miért probléma? Azért, mert prebiotikus környezetben nincs természetes szelekció. „A prebiotikus természetes szelekció önellentmondás.” (Theodosius Dobzhansky) Természetes szelekcióhoz szükség van replikátorra, a replikátor működéséhez szükség van a sejtben működő fehérjékre és egyéb – rendkívül összetett, információvezérelt – folyamatokra. Ezek egyike sem áll rendelkezésre, amíg nincs működő sejt. Az autokatalízis nem valódi reprodukció, hanem csak spontán újramegjelenés, amit szelekciós előnnyel bíró rendszerek és szelekciós mechanizmusok híján nem tud semmi sem kiválasztani és átörökíteni.

    A ribozim autokatalízise kb. olyan távol van az élet eredetének magyarázatától, mint az, ha valaki egy svájci óra megépülését próbálná úgy magyarázni, hogy a fémgyűjtő helyeken időnként látunk fémkarikákat egymás mellett heverni a földön, amelyeket ha erős vízsugárral locsolunk, más-más alakzatban is összeállnak, és ha elkülönítjük, összekötözzük, majd újabb vízsugárral locsoljuk őket, egészen komplex alakzatokat is felvesznek. Hiába hozunk így létre (direkt evolúció révén) komplex alakzatokat, ezek nem funkcionálisak, hiszen a funkcionalitáshoz – különösen a rendszerszintű működés funkcionalitásához, amilyen egy óra vagy a sejt – tudatos tervezésre van szükség. Ezért van az, hogy ha fémkarikákat látsz egymásra dobálva, nem feltételezel tervező intelligenciát, viszont ha egy működő órát látsz, azonnal tudod, hogy azt valaki megtervezte.

    Ahhoz, hogy az első élő sejt megépülése kapcsán a probléma nagyságát átérezzük, muszáj értenünk a funkcióspecifikus információ természetét, és hogy azt bizonyos komplexitás felett irányítatlan anyagi folyamatok miért nem képesek előállítani. Ezért hangsúlyozom újra és újra a funkcionálisan specifikus információ kérdését. Sztochasztikus folyamatok egész egyszerűen nem hoznak létre olyan információs rendszereket, mint amilyen egy svájci óra, vagy az annál sokkal-sokkal komplexebb és információdúsabb celluláris rendszerek. Az autokatalitikus folyamatokra épülő hipotézisek az élet eredetének magyarázataként ezért olyanok, mint a perpetuum mobilével való kísérletezgetés. Utóbbi annak idején az energia természetét nem vette figyelembe, előbbi az információ természetét hagyja figyelmen kívül. Mindkettő zsákutca.

    Az ok, hogy mégis miért hisznek sokan abban, hogy egyszer rájövünk az élet spontán keletkezésének titkára, nyilvánvalóan a naturalista metafizika, amely a tudományos kutatásokat jelenleg gúzsba köti. A naturalista világképben csakis irányítatlan anyagi folyamatok által jöhetett létre a kozmosz és az élet, ezért bármennyire is lehetetlennek tűnik, mindkettő esetében azt kell feltételezni, hogy valahogy mégiscsak létrejöttek, csak még nem tudjuk, hogyan. Teistaként ezt abszurdnak tartom, és mivel nem voltam soha materialista, őszintén szólva nehéz is átéreznem, hogyan válik bárki számára is plauzibilissé ez a metafizikai alapállás és az ebből következő módszertani keret. Összehasonlíthatatlanul racionálisabb számomra a teista világkép, amely a világot teremtettnek tartja, mint a materializmus, amely néhány fizikai állandónak tulajdonítja mindazt a komplexitást, amit magunkban és magunk körül észlelünk.

  • Veszt says:

    Lima Rui: Sejtem, hogy miért használod a fejlődés szót, de ahogy te is írtad azért érezzük, hogy zavar van az erőben. Darwin látta az élőlények alkalmazkodását és levont következtetéseket a természetes szelekcióra vonatkozóan és ebből jött egy sejtése, hogyha az élőlények képesek alkalmazkodni és ez morfológiai változásokkal járhat akkor lehet hogy ez lehet a fajok eredetére a válasz. De ez semmi több nem volt egy sejtésnél, mert hiába telt el Darwin óta több mint 100 év és van már molekuláris biológiai eredményünk mégse tudunk semmit a fajok eredetéről, ugyan úgy azt figyeljük meg, hogy az élőlények alkalmazkodnak és közben színes fantázia festményeket rajzolgatunk, törzsfákat készítünk, mert nem lehetett másként. Én a józan eszemmel azt az ugrást nem tudom felfogni, hogy az élőlények alkalmazkodóképességétől hogy lehet eljutni a fajok keletkezéséig, az élet keletkezéséig, amikor erre nincs semmilyen igazolás. Az összes evolúció biológiai közlemény csak az élőlények alkalmazkodásáról, annak genetikai hátteréről értekezik, már meglévő biokémiai utak működéséről. És most ne értsd félre értékelem és becsülöm ezeknek az embereknek a munkáját és nagyon hasznos amit csinálnak, de miért hívják evolúcióbiológiának amikor nem az evolúciót vizsgálják? Persze erre te mondhatod, ahogy korábban is tetted, hogy nagyok az elvárásaim, de én itt nem nagy elvárást látok hanem csak korrektséget, ne mondjuk valamire, hogy evolúció ha nem az.
    genetikai sodródás: hogy érted, hogy nem a szelekció határozza meg, oké hogy véletlenszerű, hogy mely allél szaporodik fel, de arra ugyan úgy hat a környezet, csak nem sejt és egyed szinten, hanem populáció szinten, ha a felszaporodott allél káros a populáció kihal, ha hasznos vagy semleges életben marad, pont mint a mutációnál, csak a genetikai sodródás populáció szintű folyamat és nem egyed szintű.
    “pedig egy gén sokféleképpen elromolhat”: ez pont hogy nem igaz, vannak mutációs hot spot-ok, ennek oka többféle, de igazolva van hogy egy génnek vannak olyan helyei ahol a mutációk szinte egyáltalán nincsenek és vannak olyan szakaszok ahol gyakoribbak.
    Hogy milyen egy jószándékú istenkép nem tudom, az meg külön furcsa mikor valaki erkölcsileg kezdi el kiosztani Istent, hogy mit hogyan kellene csinálnia és akkor milyen jó lenne. Isten a Bibliából ismerhető meg és a bibliai istenkép az eddigi ismereteim alapján jól magyarázza a jelenlegi világ működését, sokkal logikusabb és tisztább képet ad, Occam borotvája nálam éppen az evolúció elméletét vágja el, ahol túl sok a “ha”, a “véletlen” és az “úgy sincs más”. Lehet a te istenképedben az isten egy nemtörődöm, rosszándékú, megsavanyodott öreg bácsi, de a Biblia Istene megnyugtatlak nem ilyen.
    Fizika és biológia: az életben az a csodálatos, környezet energiáinak megkötésére képes és ezt használja fel önmaga sokszorosítására, ha nem kap energiát a rendszer akkor nem működik. Lehet beszélni önreprodukáló ribozimról, de az egész visszás mikor mindent alápakolnak hogy működjön, hőmérséklet, pH, szubsztrátok, nyomás, stb. Ilyen alapon egy PCR készülék is egy korai élőlény, csak kell neki a 220V. Tehát nem csak a nukleotid sorrend számít. A korai élőlényeknél az egyik legsarkosabb felvetés az önreprodukció mellett a lipidmembránréteg ami képes a környezetet biztosítani mert anélkül nem működik a dolog és akkor már mindjárt ott tartunk, hogy már ki is kell lépnünk a DNS-RNS-Fehérje körből, mert az is csak sejthártyán belül működőképes, és ha már eddig is a valószínűség lehetőségének vékony mezsgyéjén gyalogoltunk az még valószínűtlenebbé vékonyodik.

  • dzsaszper says:

    Kedves Lima Rui,

    “A bolygók keletkezését se figyelték meg. Figyeltek meg más rendszerekben olyan folyamatokat, melyet bolygókeletkezésnek tudtak be. Ezek is science fiction?”

    Nem feltétlen, de nagyon más történet sokezer, millió bolygó keletkezésének ismétlődő nyomait figyelni, mint egy konkrét bolygó egyszeri és megismételhetetlen fejlődéséről értekezni.
    Míg az előbbi, ha cipőkanállal is de beleférhet egyfajta természettudomány-fogalomba, az utóbbi vagy igazságügyi szakértés, vagy science-fiction.

  • dzsaszper says:

    Kedves Lima Rui,

    „Számomra ez egy igen komoly tudományos érv az abiogenezis lehetetlensége mellett… Programozási nyelvek maguktól nem szoktak az ölünkbe potyogni abiotikus úton „
    Ez nem kellett volna a végére. Sok minden nem potyog az ölünkbe, mégis létezik. És honnan tudhatnánk mi minden potyogott 4 milliárd évvel ezelőtt?

    De, ez nagyon is kellett a végére, mert ez a lényeges érvem összefoglalása.
    Szerintem is sokféle dolog potyogott az ölünkbe. De mi potyoghatott és mi nem potyoghatott abiotikus úton? Ez itt a lényeg.

  • dzsaszper says:

    Kedves Lima Rui,

    De örülök, hogy végre itt egy ember, aki esetleg tudna válaszolni a kérdéseimre, amik jóval régebbiek, mint ez a vita. Biztos sok naiv, sőt, hülye kérdés is fog most jönni. Értem én, hogy bit, de azok fizikai, materiális hordozó mik? Ha leütök egy billentyűt, pl a „H”-t, akkor elektronok adják a jelet tovább? Hogy viszi az elektron az 1-et és a 0-át? 0-nál kimarad? Az adatcsomagokat mi értelmezi és hogyan? A logikai kapuk hogy néznek ki? A tranzisztorok mit csinálnak?

    Úgy tűnik, egy kicsit egyből el is kell keserítselek. Olyan mintha egy Java fejlesztőt kezdenél el egy konkrét mikroprocesszor részleteiről kérdezni. Őt úgy is csak az fogja érdekelni, van e Java virtuális gép megvalósítás az adott környezetre, és ha igen, köszöni szépen, neki elég az 🙂

    Nézzük a ribozim példáján keresztül. A ribozom összeilleszti az A és a B komponenst, ez a ligálás. Ezt hogy írod le programba? „Illeszd össze a következő két adathalmazt, hogy A után következzen B”. Persze fel kell ismerni A-t és B-t és megfelelően összeilleszteni. És utána, ha összeilleszti, akkor ez is képes leadni ugyanazt a parancsot? Hisz A mondjuk az, hogy: „Illeszd össze a következő két adathalmazt,”, B meg: „hogy A után következzen B”. Persze programnyelvben. Az hogy néz ki? (Ha hosszú, elég egy rövid szakasz is, csak hogy el tudjam képzelni. Milyen karakterek és főleg hány?) Hogy értelmezi a program az adatsort? Honnan tudná, hol ér véget az első és hol a második? A betű/bit a nukleotid, a szó a struktúra, a program az egész ribozim. De a biteket kell értelmeznie valaminek, nem? Egy másik programnak? A nukleotidok megfelelő sorrendje felveszi a térszerkezetet és a kettő együtt végrehajtja a ligálást tehát értelmezi az utasítást, ami által lesz egy új, teljes nukleotid sorrend és térszerkezet, mely azt meg tudja ismételni. Ilyet tud egy számítógépes program?

    Persze hogy tudnak ilyet a programozási nyelvek, amit te kérdezel, azt hívják string-konkatenációnak. Jellemzően van rá egy gépi kódú utasítás is, ami egy egyezményes lezárójelig olvas egy adott kezdettől A-t is B-t is, és létrehoz egy másolatot összefűzve, a végén az egyezményes lezáró jellel. De ha trükközésre van szükség, apróbb utasítások ciklusából olyan algoritmust implementálsz, amilyet akarsz 🙂 A dolog ott kezd érdekes lenni, amikor ciklusok, feltételes kódrészletek vannak egymásba ágyazva sok szinten keresztül — ezért mondtam korábban, hogy az expresszióvezérlés a programozás lényeges része.

    Ami a konkrét DNS-RNS utasításkészletet illeti, sajnos nincs elég információm, mindenesetre az ENCODE projekt cikkei meggyőztek arról, hogy a fehérjeszintézis egyfajta assembly nyelvhez hasonló utasításkészletre épül.

  • dzsaszper says:

    Kedves Lima Rui,

    végül a 66 nukleotidból álló RNS molekuláról:
    Első ránézésre a legegyszerűbb régi MS-DOS-os vírusokhoz hasonlítanám, de valószínű a legközelebbi biológiai hasonlat is a vírus. Uugyanis mindegyiknek kell egy környezet a “reprodukcióhoz”. Az RNS-nek megfelelő kósza molekulák a közelben szabadon… a vírusnak egy hordozó… és a megfelelő molekulák szabadon jó eséllyel egy hordozó élőlényben vannak meg 🙂

    Ádám korrektül világított rá, hogy irányított kísérletek folytak, volt tudós a háttérben, aki lényegében mérnök vagy szakács módjára recepttel kísérletezett.

  • Lima Rui says:

    Az élet fája:
    http://lifemap.univ-lyon1.fr/explore.html
    Érdekes és értékes oldal, élvezet tanulmányozni.
    De az egésznek nincs semmi értelme, ha nincs evolúció. Az egész tévedés lenne? Ez a sok összefüggés és kapcsolat mind téves eredmények halmaza? Sok száz és ezer félrevezetett tudós munkájának fáról (bocs) lepotyogott gyümölcse?

  • dzsaszper says:

    Kedves Lima Rui,

    örültem volna, ha reagálsz az utolsó novemberi kommentek bármelyikére…

    Az evolúciót egészében én sem vitatom.
    Az abiogenezisre és a kezdeti filogenezisre vonatkozó elméleteket viszont nem tartom a tudomány hatáskörén belülieknek, tehát nem is tartom őket tudományos elméletnek egyáltalán. 🙂

  • dzsaszper says:

    Bocs, kicsit pontosítok, elsősorban nem tartom természettudományos elméletnek — amely meghatározásra a biológusok viszont általában igényt tartanak, és használják a természettudomány eszköztárát (beleértve pl Occam borotváját).

  • Lima Rui says:

    Kedves dzsaszper!

    Sűrű időszak volt ez számomra, többek között megszületett a kisfiam, továbbá rákapcsoltam a doktorim írására is, így nem tudtam időt szakítani egy hosszas válaszra.
    Az abiogenezis valóban ingoványos terület, ebben egyetértek, de hogy máshogy lehetne megbizonyosodni az élet keletkezéséről, mint elméletek felállításával, azok kutatásával, bizonyításával? Lehet, hogy elérhetetlen a cél, de ha egyesek ezt kutatják, tegyék, ártani nem árt. A tér és az idő olyan akadályok, melyeket nem lehet megkerülni, így nekünk kell engedni: perdöntő bizonyíték valószínűleg sosem lesz. Hogy is lehetne? 3,8-4 milliárd éves protosejtekről beszélünk, sőt, molekulákról. Korábban beszéltünk a bolygókról:
    ““A bolygók keletkezését se figyelték meg. Figyeltek meg más rendszerekben olyan folyamatokat, melyet bolygókeletkezésnek tudtak be. Ezek is science fiction?”

    Nem feltétlen, de nagyon más történet sokezer, millió bolygó keletkezésének ismétlődő nyomait figyelni, mint egy konkrét bolygó egyszeri és megismételhetetlen fejlődéséről értekezni.”
    A válaszod valójában nem volt kielégítő. Sok ezer, millió bolygó VÉLT keletkezésének ismétlődő nyomat lehet megfigyelni. Hiába ismerünk több ezer bolygót, látunk több ezer VÉLT bolygócsírát, a kettő összekapcsolása csak elméletileg lehetséges, hisz ez az átalakulási folyamat több százezer évig eltart.
    De akkor kanyarodjunk oda, aminél (egyelőre és eddig) végképp feladtam a próbálkozást:
    A ribozimmal kapcsolatban ez volt az egyik válaszod:
    “Ádám korrektül világított rá, hogy irányított kísérletek folytak, volt tudós a háttérben, aki lényegében mérnök vagy szakács módjára recepttel kísérletezett.” Kénytelenek voltak, hisz sajnos egyetlen tudósnak sem áll a rendelkezésére fél milliárd év. Igen lassú és ritka folyamatokról van szó, lehetetlen és nem is várható el, hogy ezt bárki kivárja a laborban. Ha spontán abiogenezist vársz el, akkor azt a kísérletet már a trilobitáknak el kellett volna kezdenie.
    De nem is ez a fontos a ribozim kapcsán, csak nem fejtettem ki, nem szeretek mindent szájba rágni. Korábban félszáz hozzászóláson keresztül azt fejtegettem, hogy mi a különbség a biológiai és emberi kódolás között. A ribozim A és B alegysége immáron AB-ként összeállva katalizálja a többi A és B alegység összeállítását. Ez egy ligálás, ahol a ligáz önmaga másolatait hozza létre, melyek további ligálásra képesek. És mindez 66 db ribonukleotid megfelelő térszerkezete miatt, melyek bizonyítottan létrejöhetnek spontán, formaldehidből (igaz, nem ez a preferált kimenetel), mely jelen van a világűrben is, csillagfelhőkben, csillagok körül. Te ezt válaszoltad többek között: “Persze hogy tudnak ilyet a programozási nyelvek, amit te kérdezel, azt hívják string-konkatenációnak. Jellemzően van rá egy gépi kódú utasítás is, ami egy egyezményes lezárójelig olvas egy adott kezdettől A-t is B-t is, és létrehoz egy másolatot összefűzve, a végén az egyezményes lezáró jellel. De ha trükközésre van szükség, apróbb utasítások ciklusából olyan algoritmust implementálsz, amilyet akarsz” De nem gondoltad végig. Honnan tudja a programnyelv, hogy a lezárójelig kell leolvasnia a kódot? És honnan tudja hogy azt aztán összefűzze? A programnyelvet valaki létrehozta. Sőt, mindezt egy számítógép végzi, melyet valaki létrehozott. A ribozim-féle string-konkatenációhoz nem kell más csak formaledhid és idő. Lehet, hogy A-t és B-t egy laborban rakták össze, hisz nem volt a tudósoknak több millió éve, hogy magától létrejöjjenek, de azok működnek egy alap pufferben. A te string-konkatenációd milyen pufferben működik? Mi kell ahhoz a pufferhez? Remélem jól érzékeltetem a különbséget. A ribozim programnyelv mérhetetlenül egyszerűbb, mint a tiéd. És más szinten működik. A tiéd virtuális, melynek lehet valós eredménye, valamit vizualizálhat vagy működtethet egy robotkart, de A és B nem valós, max virtuális manifesztációk, ahogy AB se valós, vagy van valós manifesztációja (mozog a kar). A ribozim A és B-je 1-1 molekulalánc, ami azért teszi, amit tesz, mert olyan a térszerkezete. A struktúra maga a funkció. A te programnyelved térbeli megfelelői áramkörök és elektronok, melyek akármennyi programnyelvnek is otthont adhatnak, csak a programozón múlik. A te lezárójeled bármi lehet. A lezárójel mást is csinálhat. Ezek nem determináltak, ezek értelmetlen jelek, melyeknek te adsz értelmet.
    Valamint:
    “Az evolúciót egészében én sem vitatom.”
    Ádám viszont vitatja, mégis csak az én állításaimmal vitatkoztál.

  • “De az egésznek nincs semmi értelme, ha nincs evolúció. Az egész tévedés lenne? Ez a sok összefüggés és kapcsolat mind téves eredmények halmaza? Sok száz és ezer félrevezetett tudós munkájának fáról (bocs) lepotyogott gyümölcse?”

    Hat ez igy van, a tudomanyban a tenyek uralkodnak es elmeletek dolnek konyortelenul ossze. Mit gondolsz, anno azt mondtak, hogy a tortenelmi inevitabilitas az hogy az evolucio atveszi a helyet a teremtesnek. Ez mindket iranyban mehet. Nem?

  • dzsaszper says:

    Kedves Lima Rui,

    Gratulálok a fiad születéséhez!

    Egyetértek azzal, hogy ay élet keletkezésével kapcsolatban is, mint megannyi más dologgal kapcsolatban is elméletek felállításával és versenyeztetésével lehet előre jutni.
    De hogyan versenyeztetjük az elméleteket, és mi alapján mondjuk azt, hogy így történt, úgy történt, akár így is történhetett, úgy nem történhetett? Erre az élet sok területe sok eltérő választ ad.
    A természettudománynak megvannak a maga versenyeztetési szabályai, köztük Occam borotvájával, amelyek falszifikálható, reprodukélható kísérletek esetén működnek. Te magad is elismered, hogy ezekkel a feltételekkel gond van.
    Ott van az igazságügyi szakértés ami egyszeri, megismételhetetlen eseménysorozatokat vizsgál. A bíró azt fogja kérdezni, kizárható-e egy elmélet, vagy maradt-e éssszerű kétség a bizonyítandó elmélet mellett? Occam borotvája nem alkalmazható egy perben…
    Ott van a régészet, a maga szintén nem természettudományos módszertanával…
    És még lehetne sorolni…

    Ami a bolygókeletkezést illeti: legalább falszifikálható az elmélet azáltal, hogy a további vélt vagy valós bolygókeletkezésről szóló jövőbeli empirikus adatokra megcáfolható előrejelzést adunk. Nem sok ilyen falszifikációs lehetőséget látok a biológiai eredetkutatás mai elméleteihez.
    Ha kicsit visszamegyünk pár évszázadot, Darwin tett is ilyen előrejelzáseket, csak azok egyáltalán nem jöttek be, és az általa leírtak szerint a mostani adatainkkal el kellene vetni az egészet 😉

    Szerintem nem kérdés, hogy a klasszikus természettudományos eszköztár az elméletek versenyeztetésére eredetkutatásoknál nem alkalmazható, mert ezek túl vannak a falszifikálható, reprodukálható határon.
    Aki eredetkutatást művel, az már nem klasszikus természettudományt müvel. és nem árt, ha ezzel tisztában van.

    Ami a spontán ligálást illeti, még gondolkozom egy részletesebb válaszon.
    Egyrészt, lehet hogy csak alapanyag, idő, miegymás kell a ligálásodhoz…
    A bitsorozatok írásához is kb ez kell, meg egy pici szoftver ami random biteket ír… Mégis, ha egy bíróságon védekeznék azzal, hogy az oprendszeremet és egyéb szoftvereimet én írtam a véletlen biteket író programommal egy hipergyors számítógépen évek alatt, úgy, hogy azokat a mintákat tartottam meg, amik ígéretesek voltak, akkor körberöhögnének…
    A genom létrejöttéhez nagyon nagyon nem elég ez a spontán folyamat…

    Más kérdés, hogy egy képzeletbeli fosszilis számítógépet sokezer év múlva, Neumannt és sok mindenki mást elfelejtve hogy értékelnének, ha megpróbálnák a processzorok fejlődését leírni a történeti ismeretek nélkül… Lehet hogy elkezdenének elméleteket felálltítani egy egyszerű csip és egyszerű csipépítő robot ötlete mentén, ami aztán bonyolultabb csipeket és robotokat gyártott, amik még bonyolultabb csipek és robotok gyártására voltak képesek maguktól…
    Ami ebből kisülne, az félelmetesen hasonlítana a törzsfejlődés-elméletre…

    Végül egy utolsó komment: szerintem férleérted Ádámot, hogy pontosan mit is tagad és mit nem…

  • jgabor says:

    Lima Rui,

    Azért valami itt tart téged ezen a fórumon! 
    Én is gratulálok a fiad születéséhez, nagy dolog ez! Az élet egy csoda. Nemrég olvastam valahol: „Mikor először belenéztem a gyermekem szemébe, azóta tudom biztosan, hogy van Isten!”
    Persze a tudomány embere számára ez egy idealisztikus reakciónak tűnhet, de Pál apostol szerint (tudom, ő sem volt biológus  ) az istenhithez az értelem felől is el lehet jutni:

    „Mert ami megismerhető az Istenből, az nyilvánvaló előttük, mivel Isten nyilvánvalóvá tette számukra. Ami ugyanis nem látható belőle: az ő örök hatalma és istensége, az a világ teremtésétől fogva alkotásainak értelmes vizsgálata révén meglátható.” (Pál levele a rómaiakhoz 1:19-20)

    Mivel szereted az okos embereket, én Kroó Norbert kutatóprofesszort ajánlanám figyelmedbe, aki jelenleg az MTA alelnöke és egyúttal hívő ember. (A kispesti baptista közösség tagja.) Igaz, ő sem biológus, hanem fizikus, de talán érdemes odafigyelni rá.

    Tudomány és Teremtés című előadását meg lehet hallgatni pl. itt:
    https://www.youtube.com/watch?v=2kxKEFfEzoQ

  • Szabados Ádám says:

    Lima Rui,

    én is gratulálok a fiad születéséhez.:)

  • Lima Rui says:

    Köszönöm szépen a gratulációkat. Csodálatos időszak ez. Egy új élet, a felelősség és egy teljesen új világunk számunkra.
    jgabor: Szeretek értelmes emberekkel vitatkozni és a világképemet ütköztetni teljesen más világképekkel. Valamint még nem érzem úgy, hogy elmondtam volna mindent. Nem vagyok maximalista, de ha valamit csinálok, ha valamit tényleg akarok csinálni, akkor azt próbálom befejezni.
    Cserhati Matyas: Ezt én is így gondolom. A hibás, rossz elmélet ne maradjon fenn, vagy módosítsák. A kommentemben arra gondoltam, hogy ez az életfa több ezer független kutató és csoport munkájának eredménye, melyet mind szigorú szakmai szabályok szerint fogadtak el. A fa ágai leginkább szekvenálási eredményeken nyugszanak. Ahogy a te genomod is jobban hasonlít a közeli rokonaid genomjához, mint az idegenekéhez és még kevésbé más rasszok genomjához, ez igaz az élőlények nagyobb csoportjaira is. Ha mondjuk a patkány egy szekvenciarészlete ATGAGGGCC, a közeli rokon egéré ATGAGGGCa, a távoli rokon kékbálnáé már ATGAcGcCC, a cserebogárban meg talán nincs is. A több 10 ezer gén egy fejlődéssort mutat, így sok közös szekvenciánk van a csimpánzzal, kevesebb a gorillával, még kevesebb az orangutánnal, stb, az egyes leszármazási vonalakra vannak jellegzetes szekvenciák. Ezeknek gyakran nincs semmi szerepe se, pl a patkány ATGAGGGCC-je ugyanazt az aminosavat kódolja mint az egér ATGAGGGCa-ja. Ennek a változtatásnak értelme nincs, csak egy megtörtént esemény. Ha úgy tetszik mikroevolúciós esemény, de az kevéssé valószínű, hogy a patkányban és egérben ugyanazon mikroevolúciós események milliói egymástól függetlenül bekövetkezzenek. A rokonság jobban magyarázza. És ez igaz az összes fajra, és így visszavezethető az összes ma élő faj egy hipotetikus közös őshöz, ahogy a bibliai Ádám és Éva is egy logikus következtetés, egy hipotetikus (vagy nem) őspár.
    dzsaszper: Ezek kategóriák, az emberi elme már csak ilyen, mindent rendeznie kell. Ahogy a fajfogalom is zötyög jó pár esetben, de a fajok 99%-ánál jól alkalmazható, így lehet pár természettudományos kérdés is, mely inkább csak elméleti szinten tartozik oda, de minden, arra a csoportra jellemző, amúgy általunk állított szabály, nem illik rá. A földi élet keletkezése egyszeri és megismételhetetlen. Ha laboratóriumi körülmények között sikerülne reprodukálni, az akkor se jelentené azt, hogy ez így történt meg. Kutatni attól még lehet. Az ID meg a hasonlók követőinek abban igaza van, hogy ha a kérdés túl van a megismerhetőség keretein, akkor ne foglalkozzunk vele. De akkor ők tegyenek úgy és hagyják meg ezt azoknak, akik viszont másképp látják.
    “A bitsorozatok írásához is kb ez kell, meg egy pici szoftver ami random biteket ír…” Mi kell egy pici szofverhez ami random biteket ír? A ribozim szoftvere egyben a hardver is, a molekula struktúrája, melyet a ribonukleotidok sorrendje és kémiai-fizikai tulajdonsága ad meg. Ez a pici szoftverre is igaz? Mi a szoftver anyagi formája a számítógépünkben? Van egyáltalán? Mi hordozza azt? Erre szeretnék választ kapni. Ez a kérdés ettől a beszélgetéstől függetlenül is érdekelt, de eddig egy informatikus se tudta elmagyarázni. Ők se tudják. Csak használják a számítógépet,a szoftvereket. Egy kémikus tud alkotni egy ribozimet 66 molekulából, melyek bizonyítottan képesek spontán létrejönni. Egy informatikusnak hány molekulára, mire van szüksége ahhoz, hogy csináljon egy ilyen “ligáló” programot? Nem egyszerűen a szoftvert, a hardvert is. Tényleg érdekelne. Nem hiszem hogy 66 molekula elég hozzá. Egy chip összehasonlíthatatlanul bonyolultabb ennél.

  • dzsaszper says:

    Mi a szoftver anyagi formája a számítógépünkben? Van egyáltalán? Mi hordozza azt? Erre szeretnék választ kapni.

    Működés közben feszültségszintek. A tárolón meg mágneses mezők, vagy egyéb fizikai állapot… ha visszamegyünk a lyukkártyákik, lyukszalagokig, akkor lyukak a kartonban vagy a papírszalagon 🙂 Vagy ha az első számítógépekhez isszamegyünk, akkor a mérnöki pulton a kapcsolók állása, amit a mérnök beállított…

    Szóval lényegében Bártmi, amit egy arra tervezett eszköz olvasni tud, és az absztrakt jelsorozatot értelmezni tudja az anyagi forma mögött 🙂

    Ami az úgymond ligáló szoftert illeti, az a kérdés, hogy egyrészt milyen elvárásaid vannak — a ligáláson kívül mit kell tudnia, milyen környezetben kell tudnia, milyen funkciókat tud használni a hardverből és az operációs rendszerből…
    Emlékeim szerint a legrövidebb számítógépes vírus MS-DOS környezethez 26 byte hosszú volt — csak fertőzni tudott, mást nem…

  • Szabados Ádám says:

    Lima Rui,

    gyönyörű és rendkívül informatív az a kladisztikai térkép, amit belinkeltél. A kladisztikát a darwinizmus (vagy a közös leszármazás) bizonyításához viszont azért nem lehet használni, mert maga a kladisztika használja azt előfeltevésként. Ha a színek alapján csoportosítanánk az élőlényeket, akkor másfajta térképet lehetne összeállítani. Az is koherens és gyönyörű volna.

    Nyílt titok, hogy a biológiában közel száz éve a közös leszármazást tekintik a legtöbb (vagy talán az összes) nyugati egyetemen az egyik legfontosabb alapfeltevésnek, amely a kutatásokat meghatározza. Aki ezt az előfeltevést nyíltan megkérdőjelezi (sokan vannak, akik ezt megkérdőjelezik, de nyíltan nem vállalják), azt lényegében kiközösíti a tudományos szakma. Ezért azon sem csodálkozhatunk, hogy sok száz és ezer tudós éppen egy olyan projektbe fektet energiát, amely ezt az előfeltevést használja a rendszerezéshez. A közös leszármazás jelenleg a mainstream biológia egyik előfeltevése. Ennek alternatívája, a tervezettség és az esszencializmus, ami mondjuk Linné rendszere mögött állt, jelenleg marginális (bár kiváló tudósok által támogatott!) nézet. Ennek eszmetörténeti (metafizikai, filozófiai, ideológiai, szociológiai és politikai), nem tudományos okai vannak.

    Hadd mondjak egy analógiát a saját tudományterületemről. A 20. században az újszövetségi hagyomány kutatását az ún. formakritikai módszer (Formgeschichte) határozta meg. Ha eredményt akartál elérni, ezt a módszert kellett használnod, ennek az előfeltevéseit kellett magadévá tenned. A módszert Rudolf Bultmann és Martin Dibelius dolgozták ki a 20. század elején. Mindenki ezen a kereten belül dolgozott, szó szerint könyvtárnyi irodalma van. Ezer és ezer és ezer vaskos kötet. A 20. század második felében azonban megjelentek olyan hangok az újszövetségi tudományon belül (pl. Birger Gerhardsson és Samuel Byrskog svéd, Rainer Riesner német, és Richard Bauckham brit tudósé), amelyek a formakritika előfeltevéseit kérdőjelezték meg. Ezeket a hangokat az első évtizedekben marginalizálták, mára viszont az érveik sikerrel rombolták le a Formgeschichte dominanciáját. A legtöbb újszövetségi hagyománytörténettel foglalkozó tudós ma már elismeri, hogy a formakritika alapos korrekcióra szorul, talán el is kell hagyni, mert az előfeltevései tévesek voltak. (Ha érdekel, részletesen is el tudom mondani, miért.) Könyvtárnyi irodalom és ezer és ezer kiváló tudós munkássága vált majdhogynem feleslegessé, mert rossz premisszából indultak ki. (A szakma kapuőrei éppen ezért mindig egzisztenciálisan is érdekeltek abban, hogy a paradigma, amin belül dolgoznak, ne változzon meg. – Lásd T. Khun)

    Ugyanis ha hibás a premissza, szinte minden, ami arra épül, hibás lesz, akkor is, ha az építés minden mozzanata egyébként hibátlan. Logikailag lehet teljesen hibátlan hosszú levezetés akkor is, ha a kiindulópontja egy hibás premissza. Formálisan tökéletes levezetés tartalmilag lehet valótlanság, ha a levezetés valamelyik premisszája hibás. Talán te is kaptál már egyest matematikai megoldásodra úgy, hogy a levezetés egy pont után hibátlan volt, csak az a számítás nem volt rendben, amelyet a levezetésed kiindulópontjául használtál.

    A biológiában a közös leszármazás premisszája a vita tárgya. Akik ezt a premisszát vitatják, egyelőre a perifériára szorultak. Lehet, hogy ez nem is fog változni, de az is lehet, hogy pár évtizeden belül nagyot fordul a biológia tudománya is, mint az újszövetségi hagyománykutatás, vagy a földrajz, ahol csak néhány évtizede gondolják úgy, hogy a kontinensek vándoroltak, illetve a fizika, ahol szintén csak néhány évtizede tudjuk, hogy az univerzumunknak volt kezdete. Vannak a biológiában is előjelei egy potenciális változásnak, éppen a molekuláris biológia területén látom ezt (Jerry Coyne panaszkodik is, hogy mennyi a „dezertőr”).

    A gondolatmenetem lényege az, hogy ha hibás a közös leszármazás premissza, akkor a kladisztika nem több egy izgalmas kirakósjátéknál. A közös leszármazás igazolásául a kladisztikát semmiképpen nem lehet használni, mert az formálisan is logikai hiba volna. A közös leszármazást pont a kladisztika nem tudja igazolni, hiszen a konklúzió nem lehet azonos a kiindulóponttal.

  • Éva says:

    Alapos és kitűnő volt ez a fejtegetés, és annyira tiszta 🙂 Hozzátenni nincs is mit, csak néhány emlék:
    Neveléstudományin valamilyen monológot adott elő – úgy általánosan a tudományról a matematikus-pszichológus (biológiához vajon hogy értett) de, azt leszögezte: “aki nem fogadja el az evolúciót, annak nincs helye egyetemen.”

    Meglepő volt matematika előadáson az ELTE-n hogy egy könyvet említett az előadó “vigyázzanak, tele van hamis bizonyításokkal és következtetésekkel” – ez az, amit SOHA nem gondoltam volna …

    Vannak dezertőrök, igen: Bjorn Lomborg ifjú titán, nagy szkeptikus, később belátta, hogy nagyok a bajok https://hu.wikipedia.org/wiki/Bj%C3%B8rn_Lomborg
    (de, ahogy olvasom, a megoldásokat illetően … de ez nem ide tartozik).

  • Pelikán says:

    Kedves Ádám,
    nagyon érdekes a legutóbbi levezetésed.
    Engem az érdekelne, hogy van-e a materialista tudományok számára mérlegelhető alternatívája a közös leszármazás premisszájának?

  • Szabados Ádám says:

    Igen, van. A közös terv. Ennek azonban kockázatos teista implikációi lehetnek, ezért noha nincs a módszertanában semmi, ami különbözne mondjuk a Darwin vagy Lyell által alkalmazott abduktív módszertől, a materialista tudósok szinte egyöntetűen elvetik. Nem minden tudós materialista, és számos Nobel-díjas tudós is a közös tervet tartotta a legvalószínűbb hipotézisnek, de állami finanszírozást ilyen projekt régóta nemigen kap. A közös terv hipotézis kutatása ezért gyerekcipőben jár még (bár egyébként régebbi a közös leszármazás hipotézisnél), viszont a Biologic Institute például ennek kutatásával foglalkozik és a Bio-Complexity szaklap ilyen jellegű tanulmányokat publikál. Mainstream tudományos lapokban is időnként megjelennek ezt a lehetőséget alátámasztó “peer-reviewed” publikációk.

  • Éva says:

    Lehet, hogy már említettem (persze Ádám előző írásában lezárta szerintem a témát) de vegyük csak elő a niche-áthelyeződést azért, mert homlokegyenest más állít mint Darwin: gondolkoztam a pintyeiről, azért folytatom.

    Darwin elméletének 5 fő eleme van (Mayr, 1991):

    1.A fajok változnak
    2.A fajok megtöbbszöröződnek (azaz, új fajok jöhetnek létre)
    3.Közös őstől való leszármazás (azaz az új fajok már meglévő fajokból jönnek létre)
    4.Gradualizmus (fokozatos lassú változásokról van szó)
    5.Természetes szelekció (a változások fő mechanizmusa)

    A fenti öt pontból kortársai leginkább a közös őstől való származást fogadták el és a természetes szelekció mechanizmusát a legkevésbé.

    Nézzük ezzel szemben a példát, az élőhely-igény, a túlélés feltételeinek változását (niche:=az a legszűkebb élethez szükséges feltétel-halmaz, ahol a faj túlélni és szaporodni képes), a niche-áthelyeződést. Két örvényféreg a példa amelyek ugyanabban a patakban élnek. Az egyik hőmérséklet-igénye 5-20 fok között van, a másiknak 10-25 fok között. Amint egy helyre kerülnek – táplálékigényük ugyanaz – és felfedezik a másikat, a hőmérséklet igényeiken változtatnak: míg az egyik már nem él meg 20 fok hőmérsékletig, hanem “igényét” visszavonja 5-15 fok közé, a másik 15-25 közé módosítja LÉTFELTÉTELEIT.

    Az 1.sz.kritérium nem vitatott. A második is, csak éppen az új fajok nem egymás ellenében jönnek létre, lásd niche-áthelyeződés: azok a férgek már nem ugyanazok! Lehetséges, hogy a Galapagos-szigeti pintyek – hasonlóan – táplálék-megosztás miatt változtak meg, például hogy az egyik fa – mert zárt szigetcsoport – nem termett annyit hogy elég lett volna mindannyiuknak, kiegészítették egy másikkal, és mert annak a magjai nagyobbak vagy keményebbek voltak, kellett hozzá más formájú csőr. Ez a hőmérséklet-megosztás alapján költői elképzelés, de igen valószínű.

    Az vitathatatlan, hogy az erősebb él túl, predáció esetén nyilvánvaló hogy a gyengébb lesz a ragadozó tápláléka. A 4 és 5-ös pont rendben van, a közös ős elfogadása is akár, csak az élet KELETKEZÉSE abszurd ebben a gondolatrendszerben.

    Az “eredet-elmélet” táplálója a Teremtő ellenesség, az Isten-ellenesség, onnan nagy erők jönnek …

  • Éva says:

    dzsaszper, olvasva az írásod, nagyon köszönöm és gyorsan megosztom azt, amit a napokban hiába kutattam az emlékeim között, erről eszembe jutott.

    Menjünk csak az eredethez. Ez csak egy érdekes tudományos sztori, de mert nem biztos, hogy mások is hallották, sőt majdnem biztos hogy nem, ezért leírom. A matematikai “fontos” felfedezésekről szól.

    Boole, megalkotva algebráját, melyben csak két mennyiség van, a 0 és az
    1, és két művelet, az összeadás és a szorzás, egy matematikus-konferencián előállt ezzel. Azon kívül hogy megmosolyogták (kinevették) hozzátették kollégái azt, hogy törvényszerű, hogy a matematikusok alkotnak valamit, amit aztán sokkal később felhasználnak DE EZT, TUTI hogy nem fogják semmikor használni (bár te jót szórakoztál vele … 🙂 ) Aztán mégis, a számítógép működésének alapja lett, mert vagy folyik áram, vagy nem – íme a két állapot …

    Fontos, hogy a gondolatainkat forráshoz vezessük vissza, egyszerűre redukáljuk annak ellenében, hogy a tudomány részekre szakadt. Egyes szakterületet napjainkban csak egynéhány tudós művel az egész világon. Specializálódott, és jaj, ha az alapoknál – vagy a SZÁNDÉKNÁL – hiba történik: hányan cipelik tovább míg aztán az egészet ki kell dobni ahogy Ádám nagy kommentjében kifejtette.

  • Lima Rui says:

    Elnézést a ritkán jövő válaszokért. Eddig se volt sok időm, de a kisfiam most teljesen kitölti a maradékot  Sőt, a munka tölti ki a maradékot.
    dzsaszper: „Emlékeim szerint a legrövidebb számítógépes vírus MS-DOS környezethez 26 byte hosszú volt — csak fertőzni tudott, mást nem…”
    Akkor semmi kárt nem okozott, csak jelen volt? Mint egy orphan/árva vírus, esetleg vírus szatellit, ami egy vírus-parazita rövid szekvencia, csupán az vírus jelenlétében értelmezhető annak, ami. Esetleg leírnád, és nem (csak) a vita kedvéért, hogy egy ligáló programhoz mi kell? Legegyszerűbb program (jó lenne leírva karakterekkel, ha lehet), legegyszerűbb környezet, de hardver is, lehet akár lyukkártyás is. Mik a minimális materiális szükségletei egy ilyen egyszerű programnak. És ami még lényeges: a ligáló program végére kell egy lezáró jel, ahogy írtad. De hogy az első ligáló program által összerakott A+B is tudjon ligálni, ahhoz a B-nek már tartalmaznia kell a lezáró jelet, hogy egyenértékű lehessen a progi a ribozimmel. Ha a B része egy lezárójel eleve, az nem gátolja ezt a program-reakciót?
    Ádám: A kladisztika az élővilág fejlődésének ábrázolása, az evolúció történetének a megjelenítése, senki se állította, hogy az evolúciót bizonyítaná. Az bizonyítja az evolúciót, amin alapszik. Az élet fája egy családfa, csak igen távoli rokonok szerepelnek rajta. Ha mind a 7 és fél milliárd ember genomját megszekvenálnák, akkor lehetne ábrázolni a rokoni kapcsolatokat. Emellett persze sok szemmel látható tulajdonság is kiegészítené ezt. A szín alapján való csoportosítás elég félrevezető: a fiam kék szemű (lehet persze, hogy babakék és el fog múlni), a feleségem zöld (+ arany heterokrómiás), én sötétbarna. De édesanyám szeme is kék, így én heterozigóta vagyok, hordozom a kék szemszín alléját. A szemszín szerinti csoportosításban igen szét lenne tagolva a családunk. Az apasági vizsgálatoknál SNP (single nucleotide polymorphism) analízis alapján megállapítható a rokonság foka. Ez egyedi mutációkon alapul, mely minden generációban egyedi módon halmozódik fel az adott ágon. A kladisztika a családfa kiterjesztése, sokkal távolabb visszanyúlva az időben. A 7 és fél milliárd megszekvenált emberi genommal felállítható lenne egy családfa, feltűntetve rajta a hipotetikus ősöket is, melyeknek a genomja nem ismert, de a jelenben élő emberek SNP lenyomata alapján lehetne valószínűsíteni a helyzetüket, ha nem is a pontos genomjukat, hisz SNP variációk el is vesznek minden generációban. Az adatokat megerősítené a családtörténet is, pl hogy az amerikai apa Spanyolországból származik és katalán ősökkel rendelkezik (sok egyedi allélel rendelkeznek a katalánok, Európa legősibb népességének viszonylag tisztavérű leszármazottai). Gondoltátok volna, hogy a genomotok jobban hasonlít a japán császáréhoz vagy egy kecsua vadászéhoz, mint bármelyik (tisztavérű) fekete-afrikaiéhoz? A Homo sapiens világ-benépesítésének őstörténete ismeretében persze ez nem meglepő. Vagy ezekben is kételkedtek? Ugyanis ha 7 és fél milliárd emberen kívül állatok és egyéb élőlények genomját is megnézzük, akkor az emberi családfa tovább szélesedik, előbb magába foglalja az emberszabásúakat, majd a majmokat, főemlősöket, stb. Nehéz elképzelni, hogy visszafele haladva a sok mutáció felgyülemlésével egy teljesen másfajta élőlény genomjával szembesülünk? Azaz: hol a mikroevolúció határa? Miért van egyáltalán? Mi az a mechanizmus ami nem engedi, hogy bizonyos mutációk ne alakulhassanak ki? Meg tudjátok mondani, hogy melyik nukleotid vagy kromoszóma különbségek felelősek azért, hogy így eltér egymástól a csimpánz és az ember? Hisz biztos nem az a bizonyos 1% teljes egészében. Persze nem tudjátok megmondani, hisz senki se tudja. Mégis állítjátok, hogy nem történhetett meg, a mikroevolúciós lépések sokaságából nem lehet (makro)evolúció. Miért is nem? Az 1% különbség az 30 millió nukleotid. Minden ember 30-40 nukleotidnyi egyedi mutációval rendelkezik. 30 millió nukleotidnyi mutáció felhalmozódásához maximálisan, 30 mutáció/generációval számolva 1 millió generáció kell. (Persze ez nem ilyen egyszerű, hisz nem minden mutáció öröklődik tovább, viszont minden generáció minden tagjában egyedi mutációk alakulnak ki, melyek összeolvadnak a következő generáció tagjainak születésekor, így jóval gyorsabb ez a folyamat.) 1 millió generáció az 20 millió év, de ne felejtsük el, hogy nem csak az ember evolválódott közben, hanem a csimpánz is, így az 1% eltérés felét mi, a másik felét ők halmozták fel. Így ez már csak 10 millió év. Hopp. Elviekben 11-12 millió éve váltunk el, ha létezne evolúció. Lehetnek egyes családokra jellemző mutációk, például valami drasztikusabb, egy deléció vagy megduplázódás mondjuk, amit könnyű nyomon követni. Ez egy marker, mely a család tagjaira jellemző. (Sajnos nálunk is van ilyen: apám ágán alvajárók vagyunk. Egy előnye viszont úgy tűnik lesz: meg lesz szekvenálva a család genomja, hisz ennek a genetikai okai nem ismertek és ennek kiderítésére ideális egy ilyen család.) Ilyen markerek viszont nagyobb családokra is jellemzőek, ahol több faj foglal helyet, pl amikkel én is dolgozok, az IRLC (Inverted Repeat-Lacking Clade) hüvelyes növények, melyekből hiányzik az összes növényre amúgy jellemző ősi duplikáció a kloroplasztisz genomból. Hogyhogy benne van ez a duplikáció a szárazföldi növények majd midnegyikében? És az mivel magyarázható, hogy a lucernában, a borsóban és csicseriborsóban (mind IRLC) ez hiányzik, továbbá a többi több 10 ezer génjük is nagyobb hasonlóságot mutat és további tulajdonságaik alapján is rendezhetőek egy csoportba? Nem csak színről van szó, hanem rengeteg tulajdonságról. (Amúgy is minek az a duplikáció a kloroplasztiszba, ha simán elhagyható? Amúgy is minek van részleges cianobaktérium-genomja a kloroplasztisznak? És sok egyéb kérdés, amire nincs válaszotok.) A laborunkban megszekvenáltak több IRLC növényt is és amikor elkérve az adathalmazt megvizsgáltam az általam kutatott gén szerkezetét, ugyanazt a rokonsági ábrát kaptam, ami ismert. Szóval én egy eddig nem ismert és még nem publikált adathalmazt néztem át és ugyanazt a kladisztikai eredményt kaptam, mint mások (csak a vizualizáció kedvéért: https://www.researchgate.net/profile/R_Geeta/publication/5852488/viewer/AS:98455779282960@1400485095648/background/2.png ).
    Más: Ezt írtad: „Senki nem vitatja, hogy a domináns paradigma ma a neo-darwinista paradigma. Azt vitatják sokan (igen, egyelőre a kisebbség, de nem jelentéktelen kisebbség), hogy a tények a neo-darwinista paradigmát támogatják.” Ekkor még nem értettem pontosan mire gondolhatsz, aztán találtam ezt a cikket: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3417645/pdf/fcimb-02-00106.pdf
    Mert ha erre gondolsz, vagy a mikrobiológus prof ismerősöd gondolt erre, akkor félreérted a problémát. Persze, hogy Darwin elmélete idejétmúlt. Az is természetes, hogy a neodarwinizmus idejétmúlt, hisz amióta kidolgozták sokat fejlődött a genetika. Úgy érzem, te ezekkel a gondolatokkal harcolsz, illetve azok akiknek a tanulmányait olvasod. Hisz, ha jól gondolom, viszonylag keveset olvasol az evolúcióról és sokat arról, hogy mások, mit gondolnak az evolúcióról. Kategóriákat használsz gyakran, érdemes rákeresni, hogy hányszor beszélsz a neo-darwinizmusról, míg én egyszer sem használom a kifejezést, max idézve téged. A kifejezést az egyetemen csak a biológia története órán használtuk, amit senki se vett komolyan. Ettől még használható kifejezés, de azt el kell fogadni, hogy a születése óta rengeteget fejlődött a genetika és az evolúciótudomány is. Így a neodarwinizmus is, de a mai formája nem az, mint 50 éve és lehet, nem is hívják így, sőt sehogy se hívják. Ma már neo-neodarwinizmus van és valószínűleg lesz neo-neo-neodarwinizmus is és talán 10 neo-előtagot is odatehetünk még, mire egy kvázi-teljes formába kerül az elmélet. Te a neodarwinizmussal harcolsz, mely alig vagy egyáltalán nem ismeri a vírusokat, a transzpozonokat, a horizontális géntranszfert, az epigenetikát. Ezek egyáltalán nem gyengítik az evolúciós elméletet, sőt erőstik, hisz jelentősen felgyorsítják a folyamatát. (Hogy kerül a sok virális és bakteriális szekvencia minden eukarióta genomjába?)
    Éva: Az örvényférges gondolatmeneted nem mond ellent Darwinnak. Valószínűleg az örvényféregnek csak egy populációja kerül az új környezetbe, míg egy másik populáció a régiben marad. Így többszöröződnek meg a fajok. Persze lehet, hogy az eredeti környezetben maradó populáció kihal, és persze olyan is lehet, hogy 1 populáció van csak eleve, aminek a környezete változik meg, nem ő kerül át.
    Amúgy az evolúció-elmélet már rég túlhaladott Darwinon, vele nem fair vitatkozni  Továbbá a faj-kérdés eleve zűrös. Ez egy mesterséges fogalom, melynek ésszerű és kiválóan ellátja a funkcióját a fajok 99,9%-ánál, de nem mindig működik. Az örvényférged is akkor tekinthető új fajnak, ha morfológiailag is sokat változott (hisz evolúcióról beszélünk, ami millió évekig tart, így pl hogy az eredeti örvényféreg tud a szaporodni a megváltozott utódaival, az nem eldönthető, hisz arról valószínűleg csak fosszilis leletek vannak.)
    Amúgy a niche-áthelyeződés szép megfigyelhető a kék- és széncinegéknél, akik ha mindkét faj jelen van, akkor más-más magasságban szereznek élelmet, a fák különböző szintjein, míg ha csak az egyik faj képviselője él a fán, akkor az egészet uralja. (Visszatérve az Ádámnak adott válaszomhoz, de persze Évának is szól: ha nincs evolúció, akkor fajok rokonsága se értelmezhető. Ilyen értelemben a kék cinegének ugyanannyi köze van a széncinegéhez, mint a tengeri uborkához. Csak tengeri ubival sosem találkozik. Az ID-sek szerint talán a Tervező az egyik alapján tervezte a másikat. Eszerint viszont a kladisztika valós, csak nem az evolúciót tükrözi, hanem a tervezés menetét. Isten is tehette így?)
    GMO téma: Ha nem gond, itt szeretnék válaszolni Évának, talán inkább ide illő a téma. „Rui, ha valaki tudományos kísérletet folytat, nem LEHET sarlatán, legfeljebb az eredményt lehet érvekkel kétségbe vonni.” Pusztai kísérlete nem felelt meg a tudomány szabályainak és az újság szégyene, hogy ennek ellenére publikálták. Elhiheted, hogy a kísérletük bárki által könnyen megismételhető lenne, csak figyelembe kéne venni a tudományos elvárásokat, mégsem közölték le sem ők, sem mások ezt az eredményt. (Ugyanez igaz Séralini-re is.) Remélem, ha mást nem is, de ezt elfogadod. „legújabb hírek arról szóltak, hogy van már bogár, ami GMO kukoricát eszik” Én nem a Monsanto-t védem. Rossz stratégiával dobták ki a terméküket és a gazdák is a saját hasznukat nézik, persze hogy megjelennek a rezisztens kártevők. Ugyebár az evolúció. (Kedvetekért mikroevolúció, bár a szóösszetételnek nincs értelme, habár láttam tudományos közleményben is.) „Úgy, amint az ember orvoslásában: egyik antibiotikum a másik után, aztán már rezisztencia következik be, majd megjelennek a “szuperbaktériumok”. Sokan tudják már, hogy ez zsákutca.” A sok buta felhasználási mód és óvatlanság miatt. De a hasonlat (mint legtöbbször) rossz: az antibiotikumok miatt más lenne a világ, valószínűleg egyikünk se élne, meg se születtünk volna. A legkisebb fertőzés is végezhetett az emberekkel. A szuperbaktériumok csak ezt hozzák vissza, nem lesz rosszabb a helyzet, mint az antibiotikumok előtt volt. Egy szuperbaktérium nem veszélyesebb a penicillin előtti ősénél, (sőt, a sok általa hordozott antibiotikum rezisztencia-gén miatt lassabban osztódik), csak hatástalanítja a leghatékonyabb fegyverünket. Ettől még a szuperbaci nem tud több embert megfertőzni, sőt, aki elkapja ugyanúgy felépülhet magától, ha elég erős a szervezete, ami nem jellemző a kórházakra, ahol ezek a bacik megtalálhatóak. „Befejezésül – tényleg – Vida Gábor akadémikus mondatai (Helyünk a bioszférában Typotex 2000): “Mint a genetika tudományterületén három évtizeden át oktató tanárember, jól tudom, hogy a gének azonosításában és működésének megértésében egészen napjainkig az általános módszer az elrontás volt.”” Így van? És? Egy gén elrontásával elveszed a funkcióját. Az okozatból következtethetsz a funkcióra. Alap reverz genetika. A génmódosított organizmusoknál olyan gént módosítanak, többnyire tesznek az élőlénybe, melynek a funkcióját ismerik, mert korábban elrontották. De ahol elrontották, annak már nincs köze a GMO termékhez. Én egy tucatnyi GMO lucernát hoztam létre, mindegyikben elrontva 1-1 gént, hogy megismerjem a gének által kifejezett fehérje funkcióját. A növények persze gyengébbek lettek, mint a nem módosított verzió, de ez érthető is, nem is azért tettem, hogy aztán a piacra dobjam a terméket, hanem hogy megtudjam a gén szerepét. (Érdekességképpen: a mutáns lucernám lassabban nő, nem képes nitrogénkötő gümőt létrehozni, ellenben hatékonyabban csírázik. Az első és a harmadik nem várt hatás volt. A piacra szánt GMO élőlények nagyon alaposan ellenőrizve vannak.)
    Amúgy: elvennéd a cukorbetegektől az inzulinjukat? Ugyanis azt génmódosított baktériumok illetve élesztőgombák termelik. Ha eszel sajtot, akkor van egy rossz hírem: az előállításukhoz szükséges tejoltó enzimet is génmódosított baktériumok termelik.

  • Éva says:

    Rui, benne vagy a szakmában, fel sem tételezed a jó szándék, sok ember áldozatos munkája miatt, hogy az IRÁNY lehet zsákutcás. A környezetünk – és mi magunk – “elmérgezettek” vagyunk, vannak kísérletek, mely szerint a táplálékban már az eredetinek töredéke van (Máray Géza vizsgálatai) vagy inkább csak nyomokban, míg a szervezetünkben – EU képviselőket vizsgáltak – számtalan méreg található 🙁

    Az örvényféreg példa csak arra szolgál, hogy a fajok IGÉNYE is változik, és azt várnánk, hogy éppen KITERJESZTIK az igényüket, ha megjelenik a másik ugyanazon élettéren belül, de mégsem, nem így van. Nem a másik ellenében élnek, hanem együttműködéssel: képesek visszavonulni, lemondani és MINDKETTŐ (a példában) így tesz a másik/önmaga javára. Teljesen más működési elv – a változatosság benne van ebben is, nyilván, génjeik szintjén – mint az öld meg, szorítsd ki a saját fajodért.
    Engem az elmélet rendszerszinten és a “lelkisége” a gondolat üzenete érdekel.

    Ez is, és az új-új-új antibiotikumok megjelenése is azt bizonyítja, hogy az “öld meg” nem járható út mert felbukkan/képződik egy másik faj/kórokozó, amin az eddigi módszer nem hatékony. Ekkor készül egy másik “ölőszer” … és így tovább: hogy is van? Egészen addig míg magát az immunrendszert támadja egy betegség (AIDS). Vagy, felbukkan egy szuperbaktérium, ami ellen védtelenek vagyunk.

    Ha egy FAJON BELÜL történik valamely módosítás, amit már pl. a gyümölcsfaoltványok esetében is tapasztaltam több évtizeddel ezelőtt, nem ugyanaz, mint az a gondolatmenet (ez működteti a rendszert) ami a “növényvédőszerek” – rovarölőszerek – majd azoknak/annak beépítésével operál.

    Prof.Vida Gábort idéztem, aki a “tanárember” kifejezést nem középiskolás szinten értette, régóta az élővilág, vagyis az emberiség megóvása miatt tartja előadásait három lehetséges “véget” vázolva fel, melyből csak az egyik a túlélés. “Nem kell megmenteni a bolygót, a természetet, mert köszöni szépen, jól van.” Mi magunk – az emberiség – fog elpusztulni. Lásd fenti idézet: “csak az elrontás volt”. Ezt nem a gének elrontási kísérletire értette, hanem az egész FOLYAMAT elrontására. Mert már megvan ugyanis a módszer, a “másik tudományban” ami a felépülésre, több mint túlélésre vezet, csak köszönőviszonyban sincs módszere a “sorozatos elrontással”. A Föld elmérgezett. A biodiverzitás csökkenése lehet, hogy visszafordíthatatlan … nem folytatom, mert Rui, benne vagy egy bizonyos tudományos világ igézetében, más kiinduló pontot – akár hatalmas eredményeivel, egész felépített, de más jellegű rendszerével – nem fogsz ezért elfogadni.

    Nem utolsósorban, idézem: “Az bizonyítja az evolúciót, amin alapszik.” Tehát egy feltételezésen. Pont ezt írta, fejtette ki Ádám igen szabatosan (szabadosan : ) ).

  • Szabados Ádám says:

    Lima Rui,

    először is: a fiadnak nagyobb szüksége van rád, mint bárkinek a földön, ezért annyi időt szánsz egy válasz megfogalmazására, amennyid van, teljesen megértem, ha nincs időd rögtön írni.

    A kladisztikai térképet te linkelted be, és a hozzáfűzött kommented alapján szerintem jogosan hihettük, hogy az evolúció indirekt igazolásaként használod. Ezért írtam válaszként, hogy a kladisztika az evolúciót nem tudja igazolni, hiszen kiindulópontként használja. A színekkel kapcsolatos hasonlatomat félreértetted, nem a szemszínre gondoltam, és pláne nem a színek öröklődésére. A félreértésedet talán az okozza, hogy magától értetődőnek veszed a közös leszármazás paradigmáját. Én nem a színek szerinti leszármazásra gondoltam, hanem egyszerűen arra, hogy az élőlényeket akár a színeik alapján is gyönyörűen lehetne kategorizálni. Ha a színárnyalatokat vesszük a kategorizálás alapjául, akkor a piros színű állatok lesznek egy csoportban, a sárgák egy másiban, a kékek egy harmadikban, és aztán az átmeneteket is annak rendje és módja szerint lerajzolhatnánk. A kladisztika sem ér ennél sokkal többet, ha a közös leszármazás hipotézise téves. És hogy téves-e, azt pont nem a kladisztika fogja eldönteni.

    A neo-darwinizmus (vagy Modern Szintézis) azért célpont, mert sokan dogmaként kezelik. Sokszor halljuk, hogy a Modern Szintézis bizonyított tény, a tankönyvek is így kezelik. Jerry Coyne, Larry Moran, Doug Futuyma és mások ma is dogmaként tekintenek rá (rengeteget olvastam tőlük). A cél elmozdítása azért nem olyan egyszerű, mert a Modern Szintézis konkrét mechanizmust ír le a közös leszármazás működési elveként. Ha a Modern Szintézist elhagyjuk, új mechanizmusra van szükség. Ezért nem akarják sokan elhagyni. Viszont éppen az epigenetika és az öröklött környezeti hatásokra történt változások ténye cáfolják a Modern Szintézist. Dennis Noble ezzel kapcsolatos előadását sokszor belinkeltem. Szerinte az epigenetika nem kiegészíti, hanem megcáfolja a Modern Szintézist. Noble nem lett ettől az ID híve, mert továbbra is ragaszkodik a közös leszármazás előfeltevéséhez és Darwin általános elméletéhez (változékonyság és természetes szelekció), de a leszármazás mechanizmusát szerinte senki sem tudja ma. Mert az eddigiek nyilvánvalóan nem működnek, és nem könnyebb, hanem nehezebb lett a terep. Furcsának tartom, hogy ennek az ellenkezőjét állítod. Az epigenetikai információ megjelenésével a funkcionálisan specifikus információ mennyisége exponenciálisan megnőtt, annak az esélye, hogy ez irányítatlan anyagi folyamatok által történt, ezzel fordított arányban csökkent. De igazából nem szeretném megint újrakezdeni azt a vitát, ami köztünk éppen az információ keletkezésének kérdése miatt egyszer már besült. Viszont az igazi kérdés az információ keletkezése.

  • dzsaszper says:

    Kedves Lima Rui,

    Legyél bátran a fiaddal. Engem a lassan haladó diszkusszió nem zavar egyáltalán 🙂

    Esetleg leírnád, és nem (csak) a vita kedvéért, hogy egy ligáló programhoz mi kell? Legegyszerűbb program (jó lenne leírva karakterekkel, ha lehet), legegyszerűbb környezet, de hardver is, lehet akár lyukkártyás is.

    A helyzet azért nehéz, mert programozás esetén előbb adott a környezet, és adott környezetre lehet megvalósítani a feladatot…
    Mindenesetre egy ligáló szofverhez Turing gépen elég néhány állapot:
    1, az első jelsorozatot másoljuk éppen
    2. az első jelsorozat végénél tartunk
    3. a második jelsorozatpt másoljuk éppen
    4. a második jelsorozat végénél járunk.
    5. kész.

    A biológiai példához közelebb áll a dolog, hogy ha a jelsorozatok elejét keresni is kell, ebben az esetben 7 állapotról beszélünk.
    Ezt elvileg 3 biten is lehet ábrázolni 🙂
    Megpróbálom egy minimalisztikus célhardveren, az ugrás méretei miatt 4 bites egységekben kihozni a szoftvert, de valami ilyesmit sejtek

    1- 2 eleje jel írása kimenetre
    3- 4 számláló beállítása 1-re (2x fusson a külső ciklus)
    5- 6 eleje jel ellenőrzése, ha megvan, ugrás előre 4-et
    7- 8 bemenet léptetése, ugrás vissza 2-t
    9-10 vége jel ellenőrzése, ha megvan ugrás előre 5-öt
    11 bemenet másolása kimenetre — kimenet léptetése
    12-13 bemenet léptetése, ugrás vissza 3-at
    13 számláló csőkkentése
    14-15 ha a számláló nem 0, ugrás vissza 9-et
    16 váge jel írása, működés befejezése.

    Tehár 16x 4 bitnyi egységen, 64 biten a ligáló program viszonylag triviálisan összehozható. Nagy trükközéssel lehet hogy lehet még biteket nyerni 🙂

    Ádámnak írt válaszodhoz: a neo-darwinizmus úgymond továbbfejlődése és túlhaladottsága jó lenne, ha az ideológiai jellegű vitákra és az ismeretterjeszésre is kihatnna… Dawkinsnál és társainál azt látom akkor, hogy egy meghaladott elmélet ideológiai/filozófiai következtetéseit nyomják ezerrel még mindig?

  • Veszt says:

    Sziasztok!

    Én is gratulálok a kisfiad születéséhez Lima Rui 🙂 Komoly ajándék.

    Néhány megjegyzés:
    “Nehéz elképzelni, hogy visszafele haladva a sok mutáció felgyülemlésével egy teljesen másfajta élőlény genomjával szembesülünk? Azaz: hol a mikroevolúció határa? Miért van egyáltalán? Mi az a mechanizmus ami nem engedi, hogy bizonyos mutációk ne alakulhassanak ki?”
    Elméletben igazad lehet, bármi lehetséges, csak az a baj, hogy ezt adatok nem támasztják alá. A modern evolúciós elmélet extrapolációval dolgozik az emberi, fajon belüli genetikai variabilitásból (ami 1% alatti) következtet a fajon túli 1%-nál nagyobb eltérésre, de ennek nincs tudományos, igazolt alapja, extrapoláció csupán. Te is pontosan tudod, hogy a mutációknak van határa. Vannak mutációs hotspotok (az esetek 99%-ban hatástalan, a maradék 1%-ban funkcióvesztés) és vannak a mutációk számára hozzáférhetetlen területek pont amiatt mert azok az adott faj szempontjából létfontosságúak.

    Azzal, hogy a fajfogalom zavaros egyetértek. De a te részedről is olvasatlanságra vall, hogy a kreacionizmust azzal azonosítod, hogy a tengeri uborka és a széncinege annyira hasonló mint a kékcinke és a széncinke. A kreacionizmus alapfeltevése a baraminológia, ami azon a bibliai kijelentésen áll, hogy Isten az élőlényeket “nemek” szerint teremtett illetve parancsolta, hogy az élőlények töltsék be a földet. Minden élőlény csoport rendelkezik egy variabilitással, hogy be tudják tölteni a Földet, alkalmazkodóképesség és ezt szépen alá is támasztja, hogy pl. nagymacskák, énekes madarak, orchideák, rosaceae, stb… bár eltérőek és alkalmazkodtak a környezethez, de mégis képesek egymással szaporodni és ez a taxonómusoknak gondot is okoz és évente rakják őket különböző taxonómiai szintre (alfaj, faj, varietas), rengeteg hibriddel, változattal. De nincs semmilyen bizonyíték, hogy a nagyobb taxonok között lenne átmenet. Elméleti “linkek” vannak, mert ahogy a dendrogrammon látszik összekötik a csoportokat, de ennek igazolt alapja nincs. A markeres bemutatásod nagyon szép de azt csak azt igazolja, hogy a pillangósok rokonok, de azt nem hogy egy közös őstől származnak a kaktuszfélékkel együtt, az már csak extrapoláció.

    Növénybiológusként a GMO-s lucernás kísérletedre reagálva az első hatás várható volt. Ha a növény nitrogén anyagcseréjét rontod (pillangósnál a gumó képzést) akkor várható a lassabb növekedés, hiszen a nitrogén anyagcsere alapja egy növény növekedésének.

  • Lima Rui says:

    Kedves Éva!
    „A környezetünk – és mi magunk – “elmérgezettek” vagyunk”
    Mégis emelkedik az élettartam és a minőségi élettartam is. De amúgy egyetértek, tönkretesszük a bolygót és közben magunkat is. Megkérdezném, hogy van autód? Én pl biciklivel járok. Szelektíven gyűjtöd a szemetet? Én igen. A mezőgazdaság tönkreteszi a földet, és habár a modern vegyszerek és az általuk megnövelt termésátlag ezt a folyamatot felgyorsítják, de az ókori mezopotámiaiak ugyanúgy kizsigerelték a talajt. De hogy az „elmérgezésünkről” beszéljek: a mai túlnemesített növényeknek jelentősen legyengült az immunrendszere, hisz a kellemetlen ízanyagok, melyeket kinemesítettek belőlük az évszázadok alatt, azok védekezéshez használt méreganyagok voltak. Ezt permettel kell pótolni. Ha nem permetezed a növényt és az nem pusztul el a kártevőktől, hisz ilyen is van, akkor a növény maga megtermeli a szükséges méreganyagokat, ami nem feltétlenül egészségesebb, mint a vegyszermaradékok. A bio teljeskiőrlésű termékeknél kevés károsabb „normális” élelmiszer van.
    Örvényféreg: azon kívül, hogy a példád csak elképzelt volt 2 dolgot mondanék. 1) „öld meg, szorítsd ki a saját fajodért.” Senki se állítja, hogy ez így működik, súlyosan félreértelmezed a helyzetet és gyanítom az egész evolúciós elméletet. Gondolom láttál természetfilmeket, ahol antilopok és zebrák békésen legelésznek egymás mellett a szavannán, pedig ugyanazt eszik. Fű van bőven, de az itatónál aszálykor már nem ilyen kedvesek egymással. 2) „Nem a másik ellenében élnek, hanem együttműködéssel: képesek visszavonulni, lemondani és MINDKETTŐ (a példában) így tesz a másik/önmaga javára.” Szép gondolat, de ilyen nincsen. Azért vonulnak vissza, azért működnek együtt, mert így a legjobb számukra. Persze ez nem tudatosul bennük, hanem a környezet, a körülmények kényszerítik a fajokra, míg végül beáll az egyensúly. A 2 örvényféreg a közös környezetben elkezd kompetálni egymással, így túlvadásszák a legcsábítóbb prédát, valamint a fiatal egyedeknek nincs lehetőségük felnőni és szaporodni, hisz túl sokan vannak a kevés erőforrásra. Az új területet nem felosztják egymás között, hanem az felosztódik, a kompetitívebb faj birtokba veszi azokat a részeket, ahol ő az életképesebb vagy ahol több a zsákmány, így a másik beszorul a kevésbé megfelelő élettérbe, ahol ő a kompetitívebb vagy az erősebb fajnak már nem feltétlenül éri meg vadászni. De akkor megint a munkámról (szeretek róla beszélni :)): a nitrogénkötő szimbiózis előnyös mind a növényi fél számára, mely biztosítja a szénforrást, ami számára nagy mennyiségben jelen van, és a baktérium fél számára is, mely a kapott szénforrás (cukor) egy részének árán nitrogént köt meg, amit a növény rendelkezésére bocsát. De a baktériumok próbálnak meglógni a munka elől és csak fel akarják zabálni a cukrot, így a növény fehérjék révén kordában tartja őket. Ez az általam vizsgált szimbiózisban már odáig fajult, hogy a növény parazitává vált: fehérjéi révén elveszi a baktériumok szaporodási képességét, ráadásul életképtelenné teszi őket a növényen kívüli életre. Nincs itt lelkiség.
    „Ez is, és az új-új-új antibiotikumok megjelenése is azt bizonyítja, hogy az “öld meg” nem járható út mert felbukkan/képződik egy másik faj/kórokozó, amin az eddigi módszer nem hatékony. Ekkor készül egy másik “ölőszer” … és így tovább: hogy is van? Egészen addig míg magát az immunrendszert támadja egy betegség (AIDS). Vagy, felbukkan egy szuperbaktérium, ami ellen védtelenek vagyunk.” Azt mondod, ne védekezzünk a kórokozók ellen? Visszasírod a fekete himlőt és a gyermekbénulást? A minden antibiotikumnak ellenálló szuperbaktérium nem lesz veszélyesebb, mint az őse volt, még a penicillin előtt. Az AIDS, azaz a HIV emberszabású őse, a SIV jóval régebbi, mint a modern orvostudomány (valószínűleg, mint akármelyik orvostudomány). A HIV az 50-es években került át emberre és azért volt lehetősége elterjedni a világban, mert a belgák emberek millióit dolgoztatták halálra bányákban és kezelték rabszolgaként Kongóban.
    „A biodiverzitás csökkenése lehet, hogy visszafordíthatatlan … nem folytatom, mert Rui, benne vagy egy bizonyos tudományos világ igézetében, más kiinduló pontot – akár hatalmas eredményeivel, egész felépített, de más jellegű rendszerével – nem fogsz ezért elfogadni.” Miért ne fogadnám el? Túlságosan rabjai lettél az összeesküvés-elméleteknek. Én aggódom a környezetünkért, a bolygónkért, a természetért, az összes élőlényért, a jövőért, a fiam jövőjéért. És esetleg tudok is tenni érte. Az biztos nem megoldás, hogy az antibiotikumokat okuljuk, mert már nem hatékonyak, és hálátlanul átkozzuk ezeket a szereket, pedig milliárdok életét mentették meg. Műtrágya és permetszerek nélkül a bolygó mezőgazdasága nem láthatna el 7 és fél milliárd embert. Igaz, ezek nélkül nem is lehetnénk ennyien, de a baj már megtörtént, a megoldáson kell gondolkodni. Ha például génmódosítással a rizs, búza, krumpli és kukorica is nitrogénkötővé tehető, akkor az évente kiszórt 200 millió tonna műtrágya mennyiségét jelentősen le lehetne csökkenteni, hisz ennek a 70%-át nitrogénvegyületek alkotják. Hagyományos nemesítéssel ez lehetetlen. Kár, hogy a Monsanto és a megavállalatok profitéhsége miatt az a kép alakult ki a GMO-ról, hogy ez csak tönkreteszi a világunkat. Az ember teszi tönkre. Hawaii-on a papayát kiirtotta volna egy vírus, ha az ember nem menti meg génmódosítással a növényt és így emberek ezreinek a megélhetését. Az aranyrizs emberek millióit menthetné meg évente. Persze jobb lenne, ha ezek az emberek hetente legalább egyszer kapnának májat, de amíg ezt nem oldják meg, addig a biológusok így tudnának segíteni. Persze a világ jobbik felén élő emberek a butaságuk miatt megmentik őket a génszennytől, igaz, ez az életükbe kerül. Én tudom, melyik oldalon állok. A kérdés az, hogy te tudod e, melyiken állsz? A GMO ellenességnek hála csak a legnagyobb cégek engedhetik meg maguknak pénzben és időben, hogy piacra dobják a terméküket, azok közül is csak azt, amelyik biztos megtérül, pedig bármelyik egyetemi labor, Magyarországon is, 30 millióból 3 év alatt szinte bármit meg tud csinálni. És akkor nem csak rovarölő mérget termelő és permetszer ellenálló kukorica lenne, hanem olyan GMO termékek is, melyek tényleg hoznak változást. Pl. növények, melyek kibírják az aszályt, melyek vakcinákat és gyógyszereket termelnének, melyek elég tápanyagot nyújtanának a szegényeknek is, akik nem tudnak változatosan étkezni.
    Ádám: „A színekkel kapcsolatos hasonlatomat félreértetted, nem a szemszínre gondoltam, és pláne nem a színek öröklődésére. A félreértésedet talán az okozza, hogy magától értetődőnek veszed a közös leszármazás paradigmáját. Én nem a színek szerinti leszármazásra gondoltam, hanem egyszerűen arra, hogy az élőlényeket akár a színeik alapján is gyönyörűen lehetne kategorizálni.” Pontosan tudom, hogyan értetted. (A szín szerinti csoportosítás amúgy is zűrös: sok élőlénynek sok színe is van, valamint változtatják azt. Itt nem csak a kaméleonra gondolok, hanem hogy tavasszal a lombhullató fák egy csoportba kerülnek a gyíkkal, míg ősszel a rókával.) A szemszínt azért választottam, hogy rámutassak arra, hogy a szín szerinti, jelen esetben szemszín szerinti kategorizálás nem rak engem egy csoportba se a fiammal, se anyukámmal, pedig bizonyítottan mind leszármazástani kapcsolatban állunk egymással. A szem színéért felelős gének tanulmányozásával viszont látnánk, hogy lehetünk rokonok. Egyre több tulajdonság és egyre több gén figyelembevételével bizonyítható lenne az, amit mindannyian tudunk. A kladisztika az összes ismert tulajdonságot figyelembe veszi, köztük a színeket is, valamint a géneket is, amik a legmegbízhatóbbak. „A kladisztika sem ér ennél sokkal többet, ha a közös leszármazás hipotézise téves.” Habár a kladisztika a közös leszármazásra épül, az valójában értelmezhető az élőlények közötti hasonlóság ágrajzának is. Önmagában arról nem beszél, hogy ez a hasonlóság az evolúció műve, vagy hogy ufók kotyvasztották ki a fajokat egymásból vagy az egész Isten „fejéből” pattant e ki. A hasonlóságok és a különbségek mértéke, ennek ábrázolása tényeken alapul. Ha ezt nem fogadod el, akkor nem érted a genetikát, nem tudod mi az a (gén-, nukleotid-) szekvencia. (A következő példák nagy része hasraütésszerű, de nem kell pontosnak lennie ahhoz, hogy igaz legyen): Ha a kék- és széncinege, valamint az ember és a csimpánz genomja 99%-ban egyezik, akkor ezek 2 külön csoportot alkotnak. A 2 csoport szekvenciahomológiája mondjuk 70%-os, így elég messze kerülnek egymástól. A cinkékhez 98%-ban hasonlít a mezei veréb, 95%-ban a túzok és 85%-ban a krokodil, míg a csimpánz-ember csoporthoz 98%-ban a gorilla, 91%-ban az üregi nyúl és 81%-ban a krokodil. Ez ábrázolható. Nem csak a színük szerint vannak csoportosítva, hanem anatómiai jegyük alapján, az egyedfejlődésük alapján, a kopoltyúívük-állkapcsuk, a koponyacsontjaik alapján. És mindezt megerősítette az is, hogy ugyanezt a hasonlóságot mutatja a szekvenciájuk is, hogy a cinkék harmadik kromoszómáján van egy ezer bázispáros duplikáció, ami hiányzik a verébből, de amúgy a gége-garat kifejlődéséhez szükséges géneket ugyanúgy szabályozzák a transzkripciós faktorok, mint a többi énekesmadárnál is, valamint a túzokkal együtt mindegyiknek van 5 olyan pszeudogénje, mely a krokodilban aktív, ugyanabban a szekvenciakörnyezetben és a fogak növekedéséhez elengedhetetlen. Az anatómiai és genetikai csoportosítás között ugyan vannak kisebb különbségek, hisz eltérő környezetben más-más jegyek fejlődnek erősebben, konvergencia, divergencia, atavizmus, hibridizáció, akármi, mint ahogy a gének se mind egyenletes sebességgel fejlődnek, van amelyiken erősebb a szelekció, illetve ez időben és térben változik is. „Mert az eddigiek nyilvánvalóan nem működnek, és nem könnyebb, hanem nehezebb lett a terep. Furcsának tartom, hogy ennek az ellenkezőjét állítod.” Nehezebb lett a terep, de épp a sok újonnan felfedezett mechanizmus miatt látjuk, hogy jóval bővebb az evolúció eszköztára, ami megmagyarázhatja az evolúciós ugrásokat, pl a szabályzás összetettsége révén, mint a mikroRNS-ek, illetve sok anomáliát is, pl a horizontális géntranszfer (HGT) révén. A vírusok, transzpozonok, retrotranszpozonok, a HGT, vírus-szatellitek, viroidok, plazmidok, prionok, ribozimek meg mind-mind egyfajta protoélet, összetett molekulák vagy mechnazimusok, melyek nem tekinthetőek élőnek, de mutatnak élettevékenységet és igen egyszerűek. Nagy túlzással, lehet, hogy mindegyikből 1-1-et bedobva egy membránbuborékba meg is kapnánk egy igazi élőlényt.
    „Az epigenetikai információ megjelenésével a funkcionálisan specifikus információ mennyisége exponenciálisan megnőtt, annak az esélye, hogy ez irányítatlan anyagi folyamatok által történt, ezzel fordított arányban csökkent.” A legelső protosejtben az epigenetikai információ, ha volt egyáltalán, valószínűleg metilációra vagy egyéb, hasonló szintű módosításra szorítkozott. Épp növeli az abiogenezis valószínűségét az, hogy a kezdeti molekula katyvaszból felépülő protosejtben sima citozinek és metilált citozinek is vannak, és az ezek közti váltás, a metiláció és demetiláció, ami egyszerű kémiai reakció, is jelenthet szabályozó funkciót. Tévesen úgy értelmezed, hogy Noble elmélete gyengíti az evolúciós elméletet, miközben csak erősíti azt és közelebb visz az igazsághoz, ami természetszerűleg bonyolultabb, mint a korábbiakban hitték. Úgy érzem, hogy a fejedben az evolúció, mint egy vallás létezik, ahol a Modern Szintézis a Biblia és a neo-darwinisták mondjuk a katolikusok, akiket nem érint meg a reformáció szele. (Amúgy érdekes, hogy ma épp a liberális a szitokszó a blogon, pedig hát Luther és Kálvin is azok voltak, persze a maguk idejében, a korban elképzelhető mértékben.) Biztos vannak ilyen tudósok is, akik nem tudnak túllendülni azon, amit egész életükben tényként kezeltek, de megváltozott. Általában ez korral is jár, a rugalmasság elvesztése. Az evolúció nem egy szent könyv, amiben le vannak írva a szavak és maximum csak az értelmezésén lehet rúgózni. Az evolúció az rengeteg folyamat összessége, melyeket nem ismerünk még mind, de gyakorlatilag évről évre bővül a lista. A tasmán ördögök 20 év után egyre ellenállóbbá válnak a harapással terjedő fertőző daganat ellen. Ez nagyon gyors alkalmazkodás, nem lepődnék meg, ha ez egy új, eddig nem ismert (evolúciós) folyamat lenne.
    dzsaszper: „a neo-darwinizmus úgymond továbbfejlődése és túlhaladottsága jó lenne, ha az ideológiai jellegű vitákra és az ismeretterjeszésre is kihatnna…” A válaszom erre részben benne van az Ádámnak adott válaszban. Igen, jó lenne. A könyvek gyakran több év lemaradásban követik a legújabb tudományos eredményeket, hisz nem lehet fél oldalnyi plusz infóért újra kiadni egy könyvet vagy megírni egyteljesen újat, ezt mind össze kell várni, a laikusoknak szóló könyvek és ismeretterjesztő anyagok meg még ezeket követik évek lemaradásával és erősen felhígítva. „Dawkinsnál és társainál azt látom akkor, hogy egy meghaladott elmélet ideológiai/filozófiai következtetéseit nyomják ezerrel még mindig?” Habár van 2 Dawkins könyvek, de még nem olvastam még el őket. Az elmélet amit védenek attól még igaz, nagy vonalakban, de biztos pontosításra és javításra szorulnak, amit állítanak. Nem vagyok evolúcióbiológus, nem ismerem a szakmát, de van egy olyan érzésem, hogy Dawkins is olyan, mint a fizikusoknak Stephen Hawking: a laikusok ismerik, de a szakma már nem ismeri el, voltak nagyszerű eredményei, biztos zseniális elme, de már nem fizikával foglalkozik, hanem a fizika népszerűsítésével, tálalásával a laikusok, a közvélemény számára.
    „A helyzet azért nehéz, mert programozás esetén előbb adott a környezet, és adott környezetre lehet megvalósítani a feladatot…” És mi a környezet egy program számára? A programnyelv? Az hogy készül? Mik a szabályai? Milyen keretek közt működik? Hogy működik? Továbbá a környezetnek is kell egy környezet, nem? Egy a fizikai valóságban, ahol mindez lezajlik.
    Veszt: „Növénybiológusként a GMO-s lucernás kísérletedre reagálva az első hatás várható volt. Ha a növény nitrogén anyagcseréjét rontod (pillangósnál a gumó képzést) akkor várható a lassabb növekedés, hiszen a nitrogén anyagcsere alapja egy növény növekedésének.” Igen, igazad van. Az eredeti mondatom nem volt teljes. Lassabb növekedést kaptunk nitrogénnel ellátott, Rhizobium-mentes táptalajon is, ami mutatja, hogy a fehérjének nem csak a gümőképzésben van szerepe. Ami nem meglepő, hisz ez egy konzervált fehérje, minden eukariótában jelen van. A lucernában, illetve az IRLC hüvelyesekben génduplikáció után lett egy új, gümőspecifikus funkció is, de ez úgy tűnik, nem szorítkozik csak a gümőre, ami érthető, hisz egyedfejlődésileg a gümő sok vonatkozásban oldalgyökér eredetű. Bár az utóbbi 2 mondatom leginkább csak az evolúció elfogadásával lenne értelmezhető 🙂
    „De a te részedről is olvasatlanságra vall, hogy a kreacionizmust azzal azonosítod, hogy a tengeri uborka és a széncinege annyira hasonló mint a kékcinke és a széncinke.” Kreacionizmusban valóban igen olvasatlan vagyok. Sőt, az egész témában. Dawkinst se olvastam. „A kreacionizmus alapfeltevése a baraminológia, ami azon a bibliai kijelentésen áll, hogy Isten az élőlényeket “nemek” szerint teremtett illetve parancsolta, hogy az élőlények töltsék be a földet. Minden élőlény csoport rendelkezik egy variabilitással, hogy be tudják tölteni a Földet, alkalmazkodóképesség és ezt szépen alá is támasztja, hogy pl. nagymacskák, énekes madarak, orchideák, rosaceae, stb… bár eltérőek és alkalmazkodtak a környezethez, de mégis képesek egymással szaporodni és ez a taxonómusoknak gondot is okoz és évente rakják őket különböző taxonómiai szintre (alfaj, faj, varietas), rengeteg hibriddel, változattal.” Na igen, ez az evolúció 🙂 „De nincs semmilyen bizonyíték, hogy a nagyobb taxonok között lenne átmenet.” Szóval a kék cinege és a varjú kifejlődhettek egy nemből, hisz mindketten énekesmadár-alakúak, de a sas már nem? Ott meg van húzva a határ? Hiába bármi hasonlóság? És az Archaeopteryx? És a Velociraptor? Hisz már tudjuk, hogy tollas és igen madárszerű dinoszauruszok voltak igen sok értelemben. A biológia hogy érzi a határt? Ha génszerkesztéssel átírnám a cinege genomját a sasévá, átírva azt a mondjuk 3%-nyi különbséget, azt meg lehetne csinálni? Ha én képes vagyok rá, akkor ez nem történhetett meg magától? „A markeres bemutatásod nagyon szép de azt csak azt igazolja, hogy a pillangósok rokonok, de azt nem hogy egy közös őstől származnak a kaktuszfélékkel együtt, az már csak extrapoláció.” Millió marker alapján mondom ezt. Maga ez az inverted repeat egy 25 kb duplikáció, mely riboszómális RNS géneket is tartalmaz, és benne van a legtöbb szárazföldi növényben, így a kaktuszokban is és több hüvelyesben is, pl a szójában, de nem az IRLC-ben. Amúgy a csicseriborsó és a lucerna (mindkettő IRLC) genomja jobban eltér egymástól, mint a miénk a csimpánzétól. A csimpánzzal az ember is egy nemből származik?
    Veszt, a kollegáid tudják, hogy kreacionista vagy? Hogy viszonyulnak ehhez? Vagy nem tudják? És akkor szerinted mit szólnának? Érne hátrányos megkülönböztetés? Kirúgnának? Elnyomnának? És ha igen, akkor ez miért lenne? Mert máshogy látod a kérdést, mint ők, vagy mert egy kóklernek gondolnának, aki úgy műveli a szakmát, hogy valójában az alapjait se hiszi el/érti meg? Nem feded fel a valós személyazonosságodat, mint én? Ígérem, nem köplek be az evolúció-hívő-ellenőrző bizottságnak. (Nem rajtad gúnyolódom, csak azokon a direkt vagy indirekt célzásokon, hogy az evolúció egy meghaladott nézet, amiben egyre többen kételkednek, csak nem merik bevallani.)

  • Gergely Erzsébet says:

    “…………. Megkérdezném, hogy van autód? Én pl biciklivel járok.
    Szelektíven gyűjtöd a szemetet? Én igen. ………………………”

    A kommentek tartalmas és értékes gondolatai között, számomra szí –
    vet melengető volt olvasni kedves Rui, e föntebb idézett részt is.

  • Szabados Ádám says:

    Lima Rui,

    emberileg megkedveltelek, ezért szívesen folytatnám veled a dialógust, viszont annyira elbeszélünk egymás mellett, hogy tényleg nem tudom, van-e értelme. A biológiában laikusként próbáltam az elmúlt években megérteni azokat a kérdéseket, amelyeken a darwini evolúcióelmélet plauzibilitása múlik, mert az ember ugye belefut olyan mondatokba is, mint például Richard Smalley kémiai és fizikai Nobel-díjasé, aki 2005-ben nyilatkozta: „Kémikusként és fizikusként… mondhatom: világos, hogy az evolúció nem történhetett meg.” Vajon miért mond ilyet egy tanult ember? És miért mondanak ilyet a Cambridge-ben, a Berkeley-n, a Chicagói Egyetemen, és más rangos egyetemeken végzett biológus, mikrobiológus és molekuláris biológus ismerőseim? (Olyanok, akik a szakmai tudásukról jó bizonyságot tettek.) Sokat olvastam, hogy megértsem a darwinizmus melletti és elleni érveket, és főleg azt, hogy min dől el egy-egy érv plauzibilitása. Arra jutottam, hogy az érvek ereje nem a szakmai tudáson múlik, nem is a részletek ismeretén, hiszen a részletek ismeretében nincs különbség a darwinizmus hívei és az általam ismert kritikusai között. Mindkét oldalon kiváló, felkészült tudósokról van szó. A valódi különbség az előfeltevésekben van, amelyek által mintát keresnek a részletekben.

    Ma, jobban beleásva magam azokba a részletekbe, amelyekről te is írsz, sokkal-sokkal fantasztikusabbnak látom, hogy intelligencia és terv nélkül maguktól létrejöhettek azok az élő rendszerek, amelyeket vizsgálunk. Pár éve még jobban el tudtam képzelni, hogy az evolúció folyamata valahogy lezajlott. Ma ezt irányítatlan formában egészen elképzelhetetlennek tartom. Az én benyomásaimnak persze nincs különösebb jelentőségük, hiszen a biológiában csak egy laikus ember vagyok. Inkább azt akarom visszajelezni neked, hogy milyen vastag a kételynek az a fala, amin az érveidnek ma már át kellene hatolniuk. Egyetértek Ernst Mayr evolúcióbiológussal, hogy az empirikus adatokat filozófiai szűrőkön keresztül vizsgáljuk. Te is ezt teszed. Rajtad naturalista filozófiai szűrő van, ezért számodra az abszolút elképzelhetetlen is elképzelhetővé válik, ha annak alternatívája a Teremtő létezése. Számomra Isten létezése összehasonlíthatatlanul valószínűbb hipotézis, mint hogy az élet információ-vezérelt, komplex rendszerei maguktól jöttek létre.

    Ha bele tudnál látni a fejembe, és meg tudnám neked mutatni, mennyire hihetetlennek hat a józan eszemnek, amit az abiogenezisről mondasz, talán meg is ijednél, milyen hosszú utat kellene ahhoz megtenned, hogy meggyőzhessél. Számomra az abiogenezis ma már olyan hihetetlen, mint mondjuk az, hogy Einstein relativitás-elméletét egy varjú írta a csőrével a tudós üres lapjaira. Csak sokkal hihetetlenebb. Sokkal. Óriási szakadék van a fejemben a szavaid és az általam ismert valóság között. Mivel a hozzászólásaidban is azt látom, hogy a köztünk lévő vita nem a szakmád részleteiben van, hanem az előfeltevéseinkben, kicsi esélyt adok annak, hogy meg tudsz győzni. És amíg te kizárólag a naturalista előfeltevéseiddel gondolod végig a dolgot, én sem foglak tudni az ellenkezőjéről meggyőzni.

    Hacsak a fiad nem győz meg.:) A fiad, aki az ateista Bill Nye szerint nem több űrpiszoknál egy teljesen értelmetlen univerzum egyik jelentéktelen szegletében. Én képtelen vagyok ezt hinni. Számomra a fiad Isten csodálatos alkotása egy személyes Isten által teremtett és az élet számára finomhangolt univerzum egyedülálló bolygóján. A fiad egy végtelenül értékes személy, aki örök életre lett megalkotva. Egy ember, aki szeretni fogja az apját, és akiért az apja is néha az életét adná, annyira szereti őt. De van-e valódi szeretet, ha mindent a fizika néhány állandója hozott össze, ahogy a materializmus állítja?

  • Éva says:

    kedves Lui
    én még nem gratuláltam a kisfiad születéséhez, most megteszem ! Gondolom,hogy nagy az öröm! Ádám írása eszembe juttatja azt a gimnáziumi osztálytársamat, akivel nagy vitában voltunk végig (ő a kemény ateizmusával én már akkor teológiával foglalkoztam) és huszonéves korunkban történt, hogy a bátyjának gyermeke született. “És mindene megvan” mondta és csak nevetgélt örömében. A kicsiknek még az anyaméhben történő csodás növekedése (már vannak filmek, ahol a hímivarsejt befúródásától követhetjük a magzat fejlődését)és a csecsemőkor gyors fejlődése, a csodálatos változások, amikor először koccan a kanál a fogacskákon … ezernyi csoda 🙂 és még több öröm !

    Előkerestem most a kedvedért egy fontos könyvet, azzal lényegében lezártam az ilyen irányú (élet keletkezése és kapcsolt körök) gondolatmenetet/mások gondolatmenetének megismerését, becsülettel átrágtam magam rajta: ez Fritjof Capra: Az élet szövedéke c. könyve, Az élő rendszerek új tudományos megközelítése alcímmel. Ez a könyv – idézem a fülszövegből – “olyan közelmúltbeli tudományos áttöürések briliáns szintézisét ajánlja, mint a komplexitás elmélete, Gaia-elmélet, káosz elmélet és az organizmusok, szociális rendszerek és ökoszisztémák tulajdonságainak egyéb magyarázatai. Capra meglepő felfedezései éles kontrasztban állnak a darwinizmus és a mechanisztikus világnézet elfogadott paradigmáival és rendkívüli, új alapokkal szolgálnak az ökológiai szabályozásokhoz, melyek lehetővé tezsik majd számunkra, hogy anélkül építsük és tartsunk fenn közösségeket, hogy a jövő generációk lehetőségeit korlátoznánk.”
    Ez a könyv lényegében “a biológia tudomány mai állásáról” szól. Az egyik legjelentősebb – amit négy év elmúltával is megjegyeztem – a Santiago-elmélet, majd Maturana kijelentése (röviden): “Az élő rendszerek kognitív rendszerek, és az élet mint folyamat, a kogníció egy folyamata”. Másképpen (Maturana és Valera szavaival): “Élni annyit tesz, mint tudni”. Tudni és nyilván, tervezni is, hiszen a lépések szintén “kogníció léptei” lehettek… Lenyúgöző az egysejtű, mely erre képes volt – ne haragudj Rui, ezt a következtetést muszáj volt levonni ebből.

    Sorban válaszolok azokra, amiket írtál és én is remélem,hogy lezárhatjuk a diskurzust.
    “Mégis emelkedik az élettartam és a minőségi élettartam is” – ehhez hozzáteszem, hogy az unokám gyermekorvosa azt mondta, “harminc éve vagyok a pályán, de ennyi beteg gyerek sosem volt még”.
    Amúgy egyetértesz …Nem, nincs autóm, és, szelektív gyűjtés? ahol élek küzdök az elmaradottsággal és évek óta gyűjtöm/keverem másoknak a konyhai hulladékát.
    Aztán, amit a legyengült immunrendszerről írsz, melyeket permettel pótolunk … de ez tényleg messzire vezet, nem hozok példát: röviden, több mint harminc éve a normális, az életünket érintő kérdésekkel foglalkozó emberként ismertem meg a biokertészetet, a környezetvédelem kérdésköreit, majd, 10 éve, már 58 évesen iratkoztam a természetvédelmi mérnök szakra, és a példa, melyet az örvényférgekről írtam, az pont egy vizsgakérdés volt ökológiából 🙂 – nem elképzelt példa volt, de elméleti példa, azt elismerem.
    Számomra azáltal, hogy nem a másik ellenében élnek – mint amit a evolúciós harc feltételez, egy “kiszorítósdi”, kimondottan “lelkiség” jött át (ha már az élet nincsen meg kogníció nélkül 🙂 ) Capra könyvében biztos, ilyet is találni.
    A természetvédelem számomra értelmetlen, miután a csővégi megoldások nem oldják meg a súlyos problémákat, azt valóban a MEZŐGAZDASÁG teljes újra-tervezése oldja meg, és meg is van: a termésátlagok tekintetében is, a permakultúrások fantasztikus eredményeket hoznak, az elmúlt években (3-4 évvel ezelőtt) a Georgikon tudományos konferencia “A jövő farmja” c. filmmel nyitott (lényege: a jövő farmja a kert, fás-ligetes, mint a Paradicsomban anno 🙂 ) http://www.dailymotion.com/video/x26gfdb_a-jovo-farmja_lifestyle Ők sem térnek vissza a múltba, a kísérletező kertész viszont főleg betakarítással foglalkozik heti két órát.

    Nem tudom mire vélni, “visszasírom a fekete himlőt”? A gyógyászatban is, a lelki bajok okozzák a testi TÜNETET forradalmasította a gyógyítást Buda László már más orvos(ok) után (előadásai,honlapja a neten) beleértve a súlyos betegségből gyógyultakat CSAK azáltal, hogy megértették, a lelkük milyen “defektje” üzent nekik testi fájdalommal, elváltozással.

    KÜLÖN, a fekete himlő -és gyógyítása – kedvenc témám :)(látod, nekem is van). Nem “vakcina” – tudományos kísérletekkel szintetizált – gyógyította meg, hanem az ember szervezetének immunválasza. Tízéves voltam kb. mikor olvastam erről. Jenner doktor tépelődése mélyen beleivódott az emlékezetembe: a szomszéd szobában fekete himlő fertőzéssel feküdt a kisfiú, akinek a napjai már – tudta – meg voltak számlálva. Nem tudta a gondolatát elhessinteni, hogy is lehet, a teheneket gondozó nők nem betegedtek meg … HÁTHA a tehénhimlő, mely pusztított az állatok között, okozta azt, hogy “megerősítette” őket?
    – Mi volna – tépelődött Jenner doktor – ha MEGFERTŐZNÉM a gyereket ezzel, meg tudnám-e menteni? Végül tudjuk, hogyan döntött: megfertőzte a gyereket, és a láz később alábbhagyott …

    Ilyen, és hasonló tépelődéseket kívánok neked kedves Rui. De lásd be, hogy összeesküvés elméletről – a magam részéről – szó sem lehet, hiszen már írtam, hogy tudom, a legjobb szándék vezet: ez kizárja, hogy “összeesküvést” gondolnék részedről/részetekről, ugye?

  • Veszt says:

    Szia Riu!
    Mivel kicsit személyesebb irányba megyünk megosztom, hogy Nagy Zoltán vagyok, majd 4 évig a doktorim után az MTA martonvásári Agrártudományi Kutatóintézetében, jelenleg Szegeden a Gabonakutatóban dolgozok kutató biológus – kukorica nemesítőként. Szegeden a diploma és doktori témám a növényi (elsősorban búza) glutamin szintetáz vizsgálata volt, ezért van rálátásom a nitrogén anyagcserére. Tudom hogy van gümő specifikus GS. És bár nem tudom pontosan milyen gént/géneket rontottál el, de ha köze van a nitrogén anyagcseréhez akkor ez várható normál nitrogén ellátottságnál is, hiszen nem a talaj a limitáló tényező, hanem a megváltozott növény. Tudtommal a gümő a megfertőzött gyökérszőrből és a környező sejtekből alakul ki, így nem tudom értelmezni az oldalgyökér eredetről szóló mondatodat, a szakirodalom nem erről ír. Ha azt írtad volna, hogy a rhizóbium baktérium úgy változtatja meg a sejtek működését, hogy az expressziós mintázat a gümőben hasonlít az oldalgyökér expressziós mintázatához egy szavam se lenne, de mivel szimbiózisról van szó, és a gümőképződésben a baktériumnak van szerepe, nem beszélnék oldalgyökér eredetről, max gyökérszőr eredetről, de az se korrekt. A konzervált fehérje is értelmezhető evolúció nélkül, úgy mondjuk hogy háztartási fehérje 🙂
    “Na igen, ez az evolúció ” Pont hogy nem. Illetve szerinted miért jobb magyarázat a jelenségre az evolúció elmélete mint a baraminológia elmélete? Az egyik nagy problémát ott látom, hogy az élőlények genetikai variabilitását és alkalmazkodóképességét és a fajok kifejlődését egy ősi sejtből úgy mossák össze, hogy fel se merül a kérdés, hogy miért is igazolja ez az evolúciót. Ott látom a szakmaiatlanságot, hogy a genetikai variabilitásból és a alkalmazkodóképességből levezetik az élet keletkezését, minden egy sejtből jött létre a szervetlen anyagból dolgot, minden bizonyíték nélkül, extrapolációra hagyatkozva. Pedig éppen az általad linkelt oldalon látszik, hogy jó nagy gap-ek vannak az egyes élőlény csoportok között, úgy tűnik hogy a biológia igenis áthidalhatatlan falakat emel bizonyos taxonok közzé és ezt nem én mondom, hanem a te általad linkelt ábra. Hogy pontosan mik voltak a “teremtett nemek” azzal a baraminológia foglalkozik, elég komoly bioinformatikai, genetikai tudást felhasználva, nem légből kapott tudomány ág. Igaz hogy már nem Magyarországon dolgozik de Cserháti Mátyás foglakozik sokat baraminológiával, publikációi is jelentek meg. Tehát a biológia nem érzi a határt, hanem látod a biológiában hogy határok vannak. És ilyenkor nem szoktam érteni az evolúció mellett kardoskodókat, hogy ők hogy nem látják a szakadékot a taxonok között, miközben az ábráikon olyan szépen felrajzolják 🙂
    “Ha génszerkesztéssel átírnám a cinege genomját a sasévá, átírva azt a mondjuk 3%-nyi különbséget, azt meg lehetne csinálni? Ha én képes vagyok rá, akkor ez nem történhetett meg magától?” Pontosan és itt már rátértél az “intelligent design” témájára 🙂
    A személyes kérdésekre válaszolva, igen a munkatársaim tudják, hogy keresztyén vagyok és hogy a Biblia fontos számomra. Van több keresztyén biológus barátom, ismerősöm és azért változó, hogy ki hogy áll az evolúció – teremtés kérdéséhez. Sokáig a teista evolúciót vallottam (Isten megalkotta az ősi sejtet, majd az evolúcióval úgymond meghajtotta), de be kellett látnom, hogy ez a Biblia alapján nem áll meg… döntenem kellett. De vannak emberek akik ezt nem érzik fontos kérdésnek, nem döntenek. Szakmai területemen jelenleg úgy látom, hogy az evolúció elfogadása nélkül/elvetésével is minőségi és hasznos munkát lehet végezni. Ha nem írom bele egy cikkbe, hogy “konzervált fehérje” vagy hogy “evolúció” még úgy is meg tud jelenni 🙂 Bár még mikor a doktori disszertációmat írtam akkor még beleírtam, hogy a GS konzervált fehérje, akkor még nem döntöttem, ma már más szót használnék helyette. Munkatársaim körében mikor feljött a téma nem kaptam lenézést, szakmai tudásom napról napra bizonyítom így nincs is alapja annak, hogy lenézzenek, vannak kisebb viták, de annyira nem meghatározó az evolúció elmélet a munkaterületemen, hogy úgymond nincs is mint vitatkozni. És amúgy azt látom szakmailag, hogy tényleg nem meghatározó az evolúció elmélet. Nem olyan axióma aminek a hiányában ne lehetne dolgozni, vagy téves következtetéseket vonnál le. Biztos vannak olyan területek (pl evolúcióbiológia ahol elengedhetetlen vagy talán a taxonómia), de szerintem az összes többi területen simán mellőzhető anélkül, hogy szakmailag hiteltelen lennél. Pont ma reggel Mórocz Sándorral beszélgettünk evolúció-teremtés kérdésköréről (ő is keresztyén biológus), de mondhatom még Pauk Jánost, Cserháti Mátyást. Az ő munkájuk is példa előttem, hogy szakmailag lehet hiteles az ember úgy is, hogy nem fogadja el az evolúciót. Hála Istennek nálunk nincs retorziója annak, hogy az ember miben hisz, evolúcióban vagy teremtésben. De nyilván én se kardoskodok amellett hogy töröljék el az evolúciót. Tudom, hogy ez hit kérdés és nem szakmai. Nem a tudományosság miatt él ez az elmélet, hanem az Isten elvetése miatt.
    Na de a reggeli beszélgetés témája ez cikk volt. Érdekes, hogy a mutáció növelésével nem értek el olyan érdemi növekedést mint amit vártak, és ma már a nemesítő cégek nem is használják a mutagenezist a munkájukhoz, a mutáció nem okoz olyan genetikai variabilitás növekedést mint várható lenne az evolúció elmélet alapján.

  • Szabados Ádám says:

    Veszt, köszönöm a hozzászólásaidat. Isten áldjon a kutatómunkádban!:)

  • Veszt says:

    Köszönöm, neked is áldott munkát a te szakterületeden! 🙂

  • Szabados Ádám says:

    Itt kettőnké most találkozott, és érdekes volt átnézni kicsit a szomszédba.:)

  • Lima Rui says:

    Köszönöm a jókívánságokat a kisfiammal kapcsolatban. Itt megtekinthető az uraság: Lima Péter Ruben, az első képen: http://szte.babyboxphoto.hu/index.php?ol=10#korhaz
    Ádám: Nem akarlak meggyőzni, csupán véleményt cseréltünk. Jó hosszan  „A fiad, aki az ateista Bill Nye szerint nem több űrpiszoknál egy teljesen értelmetlen univerzum egyik jelentéktelen szegletében.” Én nem keverek érzelmeket a dologba. Sok szinten lehet nézni a dolgokat. Bill Nye szerint nyilván nem csak a fiam űrszemét, hanem ő maga is, de nem érdekel, mit gondol. A kis űrszemét az űrszemét apjának a legcsodálatosabb dolog a világon.
    Erről jut eszembe: Másik posztnál talán írtad, hogy nem hiszed, hogy van az univerzumban máshol élet (vagy értelmes élet?). A multiverzum ellen felhoztad érvként, hogy minek elpazarolni végtelen számú világot, de ez igaz az univerzumunk alsó hangon 10^22 bolygójára is. Minek teremtene Isten ennyi bolygót, ha az ember ezekre el nem juthat. Miért ne lehetne jelentős részükön 1-1 civilizáció, a maguk Jézusával és Bibliájával?
    Vissza a meggyőzésre: Gondolom, ahogy Noé bárkájának történetének se a pontossága vagy valósága dönti el a hitedet, úgy az evolúció bizonyítása se venné azt el. (Helyesen.)
    Éva: Örülök, hogy azok közé tartozol, aki nem csak beszél a környezet és az emberek megóvásáról, hanem tesz is. Hisz bármilyen jelentéktelennek is tűnik, de ha mindenki, mind 7 és fél milliárd ember megtenné azt, amit tud, akár csak nem szemetelne az utcán (nem is értem miért ilyen nehéz ez), már jobb hely lehetne ez a bolygó.
    „Számomra azáltal, hogy nem a másik ellenében élnek – mint amit a evolúciós harc feltételez, egy “kiszorítósdi”” Az evolúció nem feltételez kiszoritósdit. Nyilván ilyen is van, de ha mindenki mindenkit kiszorítana, akkor nem maradna senki 
    „azt valóban a MEZŐGAZDASÁG teljes újra-tervezése oldja meg, és meg is van: a termésátlagok tekintetében is, a permakultúrások fantasztikus eredményeket hoznak” Magyarországon még el lehetne játszadozni ilyenekkel, de a bolygó jelentős részén nem ilyen jók az adottságok (éghajlat, talaj), ráadásul a klímaváltozás (ami súlyosan fogja érinteni a magyar mezőgazdaságot is) és a népesség-növekedés ezt a helyzetet még nehezebbé teszi. Attól tartok (és nem csak én), hogy 30 év múlva nagy sírás lesz.
    Jenner: Én úgy tudom, hogy a kertész szellemi fogyatékos kisfiát használta kísérleti nyúlként: előbb megfertőzte tehénhimlővel, majd fekete himlővel, konkrétan a fiú életét kockáztatva. Ettől még sokat köszönhetünk neki, de ne feledkezzünk meg a névtelen és gyanútlan fiúról se. „a lelki bajok okozzák a testi TÜNETET” Ezt már a Jenneres példáddal te magad megcáfoltad. Persze olyan is, mint amit állítasz.
    Veszt: Az általam vizsgált génnek nincs közvetlenül köze a nitrogén anyagcseréhez, csak háztartási funkciója révén járul hozzá ahhoz is. Minket az érdekel, hogy a génduplikátomnak, a gümőben mérhető 3-5-szörös expresszió-növekedésével a többi szervhez és a paralóghoz képest, vajon mi a pontos szerepe. A rhizobium a gyökérszőrön keresztül jut be a növénybe, de a gümőfejlődés az ezzel párhuzamos program, melyet a rhizo indukál nodulációs faktorokkal. Csupán ezekkel a faktorokkal is lehet gümőképződést indukálni, illetve spontán is keletkezhetnek gümők, de ezek nem kötnek nitrogént természetesen. De a gümő a cortexből fejlődik, míg az oldalgyökér a periciklusból (így utánanézve), szóval az eredet tényleg nem jó megfogalmazás, sőt nem igaz, de a genetikai program jelentősen átfed. Amúgy a nem hüvelyes Parasponia-rhizobium szimbiózisnál a gümő szintén a periciklusból fejlődik.
    „Illetve szerinted miért jobb magyarázat a jelenségre az evolúció elmélete mint a baraminológia elmélete? „ Az elmondásod alapján csak annyi különbséget látok a két elmélet között, hogy a baraminológia elveti az abiogenezist és határt szab az evolúciónak. Ha az énekes madarak pl egy baraminológiai nem, akkor az több mint mikroevolúció, hogy ebből a nemből kialakuljon a ma ismert 5355 faj, köztük a cinegék, verebek, varjúfélék, pacsirták, pintyek, billegetők. Hogy a taxonokat az ember hogyan rendezi az más kérdés, ugyanaz a probléma mint a faj fogalmával, de ettől még a fajok közti különbségek és hasonlóságok mértéke tény. Az ember határokat szab, erről szól a taxonómia, de a biológia nem ismeri ezeket a határokat. Szakadék azért van a taxonok között, mert az jelenkori fajokat ábrázol, de a Földön valaha élt fajok közel 100%-a kihalt.
    Említetted az intelligent design-t. Azt el tudom képzelni, hogy egy földönkívüli értelem, faj korábban tervezett fajokat használ alapanyagként új fajok létrehozásához, de Istennél és a Teremtésnél nem így gondolnám. Mit mond a baraminológia? És ha az ember volt a cél, minek kellett várni közel 4 milliárd évet? Vagy 13,8-at, ha az univerzumban gondolkodunk? Ha meg intelligent design, akkor meg mi tart addig az új fajok tervezésében és Földre hozásában? (Az értelmét ne is firtassuk.)
    „Hála Istennek nálunk nincs retorziója annak, hogy az ember miben hisz, evolúcióban vagy teremtésben. „ Igen, erre gondoltam én is. Illetve amiket még kifejtettél. Maga az evolúció elmélete nem része a munkánknak, így ki se derül, ki hiszi el és ki nem. Ha meg valaki kételkedik benne, az ne kutassa, nem igaz? Ha az embernek kételyei vannak és van is rá bizonyítéka, akkor ha leközli, azzal akkorát robbantana, hogy csak ezért is megérné nem titokban tartani (plusz az igazság-faktor se elhanyagolható :). Az az érv, hogy ezek a kutatók azért tartják titokban a kételyeiket, mert különben megvonnák tőlük a kutatási pénzt, az nem állja meg a helyét. Senki se a nézeteiért kap pénzt, hanem hogy képes e megcsinálni azt, amit célul tűz ki vagy célul tűznek ki elé. Ezt az eddig elért szakmai eredményei jelezhetik előre, senkit se érdekel, hogy miben hisz. Úgy vélem, ez az érv azért létezik, hogy egy jelentős számú titkolózó személy feltételezésével az evolúció-tagadó 5,6%-nyi releváns amerikai kutató száma növekedjen. De a valóság az, hogy világ szinten az 5,6% lecsökken 1-2%-ra, hisz ismeretes az amerikaiak és az amerikai oktatás hozzáállása az evolúcióhoz és a valláshoz sok államban.
    Értem, hogy érdekel titeket a téma és jogos, hogy az ember kifejezi kételyeit egy olyan elmélettel szemben, melyet nem tart igaznak, de én úgy látom, hogy sokan úgy gondolják, hogyha az evolúció bizonyságot szerezne, az megrengetné a hitüket. Túlságosan ellentmondana a Bibliának? Úgy látom, több lépcsőfoka van a (vak)hitnek. Akik hisznek a 6000 éves Földben azok a legszélsőségesebbek. (Ilyen erővel a kormeghatározás, fosszíliák, kontinensvándorlás is csak extrapoláció.) Aztán jönnek az evolúció-tagadók. A többieket meg nem érdekli a téma és/vagy a hitük, a vallásuk, a Bibliájuk, hogy ezzel foglalkozzanak. Ha a Bibliában nem lehet 100%-ig megbízni, ha nem lehet minden szavát szó szerint venni, ha különböző értelmezési lehetőségeket nyújt, akkor akár az alapjait is kétségbe lehet vonni és akár Jézus Krisztus maga is lehet csak egy jelkép. Vagy Isten. Ezek az állítások inkább kérdések. Én így látom a problémát, erről érdekelne az érintettek véleménye. Nem vonom kétségbe, hogy tudományos szempontból is komoly problémáitok vannak az elmélettel, csak felvetődik bennem, hogy több van emögött. Még dzsaszpernél is, habár ő (talán) nem jellemezte magát hívőként, de mégis csak az evolúciót támadja (tudom, az eredeti cikk is erről szól, de azon talán már túlléptünk), nem csak az abiogenezist, és nem támadja Ádám nézeteit, valamint ezen az oldalon is jelen van (igaz, én is), ezért gondolom, hogy nem ateista.
    Amúgy mi a különbség a keresztény és keresztyén közt? (Nem a netről kinézve, hanem olyan emberektől hallanám, akik annak vallják magukat.)

  • Éva says:

    Rui, most a kertész kisfia “kísérleti nyúl” … KI oldotta meg a feketehimlő-problémát? Már fertőzött volt, lehetett, így szólt a történet. Egy heroikus lelki küzdelem volt, amiért a tehénhimlóvel megfertőzte végül és nem, a fertőzés nem tartozik azok közé, amivel lelkileg “elrontjuk magunkat” – de, ehhez meg kellene hallgatni Buda László előadásait. Mellőzöm, a neten elérhetőek, a gyógyulásokból is néhány a honlapján. A két dolognak semmi köze egymáshoz.
    Annak talán, amit pl. magamról ismerek: nagy influenzás időszakokban vidáman bírom, egészen addig, míg valami lelki probléma be nem üt. Akkor aztán ágynak esek. De nagyon érdekes, minden betegségből való gyógyulás után olyan, mintha “új életet” kaptunk volna, átjön valami friss.
    A harminc évre előre vetített gondolataidat osztom, éppen ezért halaszthatatlan, hogy újra erdősítsünk (agroerdészet, már becsengettek 🙂 ) és minden szinten, szinte mindenben járnunk kellene az új utakon. Számomra Gyulai Iván kertje a csúcs (mélymulcsos, beküldtem) a víz- légkör- talajproblémák együttes megoldásával. Sajnos, nagyon nem értik …
    Ja, hogy csak Magyarországon jók az adottságok? Mi történt Izraelben a sivatagban? “Hogy tudták a kibucokat a legszebb parkok közepén építeni” – szólt egy idétlen kérdés egy turistától 😀
    Ennek ellenében, Masanobu Fukuoka Európában utazgatva mondta: mindenütt búza, búza, búza, szőlő, szőlő, szőlő, érzem, ahogy alatta jön föl a sivatag 🙁 szóval, a biodiverzitás fontossága a mezőgazdasági “tájakra” is szól, szólna.

  • Szabados Ádám says:

    Lima Rui,

    csak három gyors záró megjegyzés:

    1. Aranyos kis tollas veréb a fiad a képen, eszembe juttatta, amikor a saját fiaimat hoztam haza a kórházból. Kicsit irigyellek ezért az időszakért (kivéve az álmatlan éjszakákat), és a képet nézve imádkoztam, hogy Isten óvja és áldja meg ezt a kis verebet.:)

    2. Az, hogy van-e inherens értelme és célja az életünknek (űrpiszok vagy nem űrpiszok), számomra nem érzelmi, hanem egzisztenciális kérdés, minden porcikámat (az értelmemet, az érzelmeimet és minden egyebemet) bevonja. Nem kell mindent (pl. a bolygók létét) értenem ahhoz, hogy örömmel fogadjam, ha Valaki azt mondja, hogy „Én alkottalak, hozzám tartozol.”

    3. Minden világnézet végső soron hit. Még a tudomány is fiduciáris keretben működik (Polányi). A scientizmus is hit, mert akinek ez a világnézete, az abban hisz, hogy a valóság megismerésének egyetlen biztos útja a tudományos módszer. Ezt a hitet a tudomány soha nem igazolta és nem is képes igazolni, mert túl van rajta (metafizikai kérdés). A te világnézeted is hit. Neked valószínűnek hat, nekem abszurdnak. Például azért, mert a legfontosabb kérdésekre semmilyen válasza nincs. Ezért hoztam összefüggésbe a szeretettel és a fiaddal, akinek a létében számomra a materializmus csődje és abszurditása megfoghatóvá válik.

  • dzsaszper says:

    Kedves Lima Rui,

    Semmi bajom a sokszorosan túlhaladott, pontosított elméletekkel önmagukban — így működik a tudomány 🙂 Dawkins tevékenységét viszont legalább annyira tartom a természettudomány hatáskörén messye túlmenő ideológiai harcnak, mint amennyire a természettudomány népszerűsítésének.

    Ha az ideológiai hadviselést félre lehet tenni, suszter marad a kaptafánál, teológus a teológiánál, biológus a természettudománynál, eredetkutató az eredetkutatásnál, igazságügyi szakértő az igazságügyi szakértésnél, akkor szerintem messze-messze értelmesebb vitákat lehetne folytatni interdiszciplínárisan, akár a biológia és a teológia között is 🙂

    A magam részéről a határtúllépést támadom, amikor az eredetkutatást megpróbálják eladni klasszikus természettudománynak, és az utóbbi módszertanát akarják alkalmazni az előbbiben.

    Tehát, amíg az evolúció megmarad a reprodukálható, falszifikálható klasszikus természettudományos tételeknél, semmi bajom vele, feltéve, ha a a klasszikus természettudomány eszköztárát (pl. Occam borotváját) használja.

    Ha az evolúció eredetkutatást művel, semmi bajom, ha az annak megfelelő eszköztárat használja, ami jelentősen különbözik a klasszikus biológia eszköztárától — pl. Occam borotváját nem lehet használni ezen a területen.

    Dawkins viszont például vadul borotválni akar az eredetkutatás területén, és innentől kezdve nem beszélhetünk tudományról.

    Más: keresztény vs. keresztyén: lényegében nyelvjárásbeli különbség, kb. mint a fel és a föl között… a keresztény népszerűbb katolikus körökben, a keresztyén pedig népszerűbb protestáns körökben. Így is úgy is a szó etimológiája a görög Χριστιανούς (krisztyiánosz, szó szerint krisztusi, Krisztushoz hasonló) szóra vezet vissza, ld. ApCsel 11,26 — sok protestáns arra hivatkozik, hogy a keresztyén változat jobban utal erre, míg a keresztény a kereszt szóval félrevezető.

    Ha meg valaki kételkedik benne, az ne kutassa, nem igaz?
    Nem igaz, az ne kutassa, akit nem érdekel a dolog, vagy nem tud a megfelelő tudományos módszertan szerint kutatni. AKinek kétségei vannak, azt érdekli a dolog, ebből a szempontból tehát bátran kutathat! 🙂

  • Lima Rui says:

    Éva: Nem csak Magyarországon jók az adottságok és biztos van olyan ország, ahol jobbak. De nálunk jók. Számítások szerint csupán a 40%-át használjuk ki a lehetőségeinknek. Izrael ellenben a tengervízből állít elő édesvizet, ami rendkívül drága, a legtöbb ország nem engedheti meg magának. A Zöld-foki szigeteken évente kb. 2-szer esik az eső, nincs ott egy csepp édesvíz sem, csak 800 ezer ember. Portugália, a volt gyarmatosító szállít nekik vizet, persze nagyon drágán. Portugália sem egy gazdag ország, de biztos jobban megéri nekik így, mint beszállni a tengervíz tisztításába. Mi itt Magyarországon (illetve a szerencsésebbik részein) el se tudjuk képzelni, milyen pontjai vannak kicsiny bolygónknak. De hogy is tudhatnánk? Benne vagyunk a világ leggazdagabb 8%-ában. Egy zsákfaluban élő roma jobban képben van, bár édesvize talán neki is van.
    Veszt: A baraminológia mit kezd az emberszabásúakkal és benne az emberrel? Hisz ez a csoport taxonómiailag kisebb csoport, mint pl az énekesmadarak. És az emberfélékkel, emberősökkel?
    Feltételezem az énekesmadarak, nagymacskák, orchidea félék és a többi baraminológiai nem nincs felsorolva a Bibliában, így a baraminológiai kutatások jutottak arra a következtetésre, hogy ezeket teremtette Isten és ebből származnak a mai fajok. Tehát a baraminológia elfogadja azokat az anatómiai, genetikai és molekuláris jegyeket, melyek ezeket a fajokat egy csoportba rendezi. De ezen jegyek egy része jelen van az eggyel, sőt többel tágabb kategóriákban is, vannak közös jegyeik, melyeket miért nem fogad már el? Továbbá ezek az ősi baraminológiai nemek is csupán extrapoláció termékei, hasonlóan, mint az evolúció hiányzó láncszemei. Ez a kettős mérce. Ráadásul sok hiányzó láncszem ismert, persze ezt ti nem ismeritek el: Archeopteryx (tudom, nem a mai madarak őse), rengeteg fogas csőrű ősmadár, Tiktaalik, lábas őskígyók, összeolvadt bordájú, de még háznélküli ősteknős. A baraminológiai mit mond az endoszimbionta elméletre?
    Ádám: Természetesen nem kell válaszolnod, sok vonatkozásban tényleg felesleges már ez a vita. Régóta az. Bár attól még felmerülhetnek érdekes témák, vagy egyes olvasók elgondolkodhatnak, még akkor is, ha itt nyilvánítanak véleményt. Korábban beszéltünk róla, hogy matematikailag milyen kis esélye van, hogy spontán kialakuljon egy 150 aminosavas fehérje: kb. 10^195. Ez egy teljesen téves gondolatmenet. Egy bizonyos 150 aa fehérje kialakulásának tényleg ennyi az esélye, de épp az evolúció nem állít olyat, hogy fehérjék célzottan kialakulnának. Ha nem pont ez a 150 aa áll össze, akkor egy másik fehérjéről beszélünk. Az embernek legalább 20 ezer fehérjéje van, a legtöbbnek van allelikus variációja is. Minden élőlények több ezer, tízezer fehérjéje van, a maguk allelikus variációival. Ha nem X fehérje alakul ki, akkor Y, vagy Z, vagy M. A fehérjék működéséhez nem is kell mindegyik aminosav, sőt. A fehérjéknek doménjeik vannak, azok látnak el funkciót. Itt egy gyakori domén, az EF-hand, mely kálciumot köt meg (maga az EF-hand együtt jár 2 alfa hélix-el is, de a kálcium kötésért ez a 12-13 aa felel): http://prosite.expasy.org/PS00018 . 12 aminosav: D-{W}-[DNS]-{ILVFYW}-[DENSTG]-[DNQGHRK]-{GP}-[LIVMC]-[DENQSTAGC]-x(2)-
    [DE]-[LIVMFYW]. A szögletes zárójelben lévők közül ott bármelyik aminosav állhat, a kapcsosnál meg egyik sem azok közül, az x bármilyen aminosav lehet, a vonás csak félrevezetésképpen van ott :). Szóval a valószínűség: 1*19*3*14*6*7*18*5*9*20*20*2*7=15^10. Az összes lehetőség 82^15. Szóval a 20 fehérjealkotó aminosav egy 13 aminosavas sort 82^15 féleképpen alkothat. Ebből a 82^15-ből minden 546 ezredik (82^15/15^10) EF-handet tud képezni, azaz a fehérjének kialakul kálcium kötő tulajdonsága. Ez már önmagában igen nagy valószínűség, nem beszélve arról, hogy 150 aa 138 féle 13 aa darabra osztható fel, ami egy fehérjén belül már 1 a 4000-hez csökkenti az esélyt. Szóval 4000 db 150 aa hosszú fehérje közül statisztikailag 1-ben valahol kialakul a kálcium-kötés képessége. Legalább 110 ezer domént ismerünk, bár ezek közül sok ugyanaz, csak más néven. Van amelyik hosszabb, de mindegyikre igaz, hogy sokféleképpen is összeállhat. Láthatod, hogy a 10^195 nevetséges érték. A biológiában nem csak 1 ötöst érő számsor van a lottón.

  • Veszt says:

    “Az ember határokat szab, erről szól a taxonómia, de a biológia nem ismeri ezeket a határokat.” Ez az amit korábban is írtam és itt nem fogunk dűlőre jutni. Én azt mondom, hogy az ember nem szabna határokat, ha annak nem lenne biológiai alapja. Nem azért vannak gap-ek a dendrogrammokban mert az ember olyat akar, hanem azért, mert a fenológiai és molekuláris adatok azt mutatnak. A fosszíliák ismeretében azt kell mondanom, hogy nincs igazad, annyiból igen, hogy sok faj kihalt, de nem támasztják alá azt az állításodat, hogy átmenetek lennének. Ha megnézel néhány cikket ami egy fajnak az eredetével foglalkozik mindig egy feltételezett, hipotetikus ősről beszélnek, melynek fosszíliáját nem találták meg, csak feltételezik, hogy így meg így nézett ki, DNS információ pedig még ritkább.
    Az intelligent design-al kapcsolatos kérdésedet nem igazán értem. Ha azt nézzük, hogy pusztán a véletlennek köszönhetően, a szervetlen vegyületekből való életnek a kialakulásának a valószínűsége nulla a 13 milliárd év alatt, az pedig hogy Isten mit és hogyan, és milyen időbeosztással csinál, persze számon lehet kérni. Tehát ha csak pusztán a valószínűséget nézzük a baraminológia hitelesebb, megalapozottabb választ ad mint az evolúció elmélet.
    Én is úgy látom, hogyha annyira egyértelmű lenne az evolúció (egyetlen ősélőlényből kialakul a ma látható és valaha élt élőlény) akkor nem beszélgetnénk így, de ez nem igazolt, bizonyított, csak egy elképzelés hogy lehetett így. Az hogy miért nem kutatják jobban ezt a területet nem tudom, lehet azért mert nem lehet jobban. Az összeesküvés elméletekben én se hiszek, egyszerűen úgy látom, hogy van sokkal égetőbb probléma a biológiában amin érdemes és kell dolgozni, mint az hogy hogy keletkezett az élet, a fajok, illetve, hogy ez a terület alapvetően nem kutatható terület, illetve nem a klasszikus módszerekkel. Nincsenek fosszíliák, túl sok a hiányzó láncszem… marad a találgatás és a szép színes illusztrációk. Valakik ezt komolyan veszik és harcolnak a vallások ellen és persze a vallásosok is próbálják védeni a maguk hitét, de ez régen nem a tudományról szól hanem a hitek ütköztetéséről és ez nem csak a keresztyénekről szól, hanem az evolúcióban hívőkről is. Ők is a maguk világnézetét féltik, mert mi lenne ha akár 1% valószínűsége lenne, hogy van Isten és a világ teremtve lett? Tehát a kritika amit megfogalmaztál a vakhittel kapcsolatban épp annyira érinti az evolúcióban, abiogenezisben hívőket is.
    Ahogy dzsaszper is írta a keresztény inkább katolikus hagyományban elterjedt szó használat, míg a keresztyén inkább a protestáns körökben használt. Nincs jelentésbeli különbség, mind kettő a Krisztus követő embereket jelöli. (Az már más kérdés, hogy valaki tényleg követi, vagy csak annak tartja magát).

  • Veszt says:

    Szia!

    Én magam baraminológiával nem foglalkozok, de sok peer reviewed cikk érhető el a témában. példa link De amit tudok, hogy az emberszabásúak és ember között is nagyobb különbségeket találtak, mint mondjuk az emberszabásúak között (tehát az emberszabásúak csoporton belül az ember jobban különbözik a csoport többi tagjától, mint azok egymástól). Hogy mely jegyeket fogadnak el és nem fogadnak el, biztos meg van a magyarázata, szerintem ha érdekel a téma olvass utána. Abban biztos vagyok hogy nem érzelmi és hit alapon választják meg a jegyeket ami alapján a baraminológiai elemzést végzik, hanem tudományos alapon. A baraminológiánál azért nem látok extrapolációt, mert nem talál ki hiányzó láncszemeket, a meglévő tényekből dolgozik, elméletének igazolását nem hipotetikus lényekkel magyarázza. De annyiból igazad van, hogy a baraminológia is ugyan azokkal az adatokkal dolgozik mint egy evolúció biológus, csak nem toldja azokat meg. Illetve a baraminológia mellett nagyon erős érv az hogy 100-200 millió éves leletekben talált élőlények ugyanúgy néznek ki mint a maiak, mintha nem lenne evolúció… persze vannak az élő kövületek (de nem csak azok, pl sok rovar fosszília, olyan mint a ma élő taxonok). Tehát a kérdésed a átmeneti fajok kérdésében felmerül, hogy valóban azok, vagy csak úgy néznek ki (pl. ha egy kígyófélének ma is van végtaggal és végtag nélkül élő taxonja, akkor lehet-e azt mondani hogy a végtaggal rendelkező az ősibb, pláne, ha fosszíliákban megvan a végtag nélküli is). Amit nagyon nehéz eldönteni, hogy az adott tulajdonság már a kezdetek óta benne van a taxon genetikai variabilitásában vagy tényleg valamikor az létrejött, evolválódott. Én itt látom a feszültséget. Nemesítőként pl. azzal szembesülök, hogy anélkül, hogy olyan gazdag genetikai variabilitás van a kukoricában, hogy egy egy keresztezéssel exponenciálisan jelennek meg “új” tulajdonságok az utód populációban (F2), amik persze nem újak, mert nem történt semmi a génállománnyal. Az endoszimbionta elméletről nem tudom mit mond a baraminológia.

  • dzsaszper says:

    Veszt, kösz a cikket, érdekes volt olvasni…

    Megjegyzés: a programozóként fel nem foghatom, a TFBS miért a non-coding kategóriába került, az expresszióvezérlés a programozás lényege, aa magam részéről legalább annyira kódolásnak látom, mint az expressziót magát 🙂

    Szerintem Mátyás is tévesen hivatkozik Occam borotvájára, bár ezt a hivatkozást leginkább iróniának vagy a (kezdeti) filogenezis indirekt cáfolatának tartom a részéről, mintsem konstruktív érvelésnek…

  • Lima Rui says:

    Egy igen hasznos GMO:
    http://zoldbiotech.hu/cikk/399-Genetikai-tt-r-s-a-haszonn-v-nyek-az-elnyelt-napf-ny-nagyobb-r-sz-t-tudj-k-n-veked-sre-ford-tani
    “annak a 140 lépésből álló folyamatnak a több évtizede tartó tanulmányozása során, amelynek segítségével a növények a napfény energiáját élelemmé alakítják, rossz hatásfokú szakaszokat lehetett kimutatni. „Vannak olyan „szűkületek”, amelyek akadályozzák a napfény élelemmé történő átalakítását” – nyilatkozta a BBC News-nak. – „Munkánk során az egyik ilyen szűkülettel foglalkoztunk.””
    Kijavítani Isten munkáját?

  • Éva says:

    “Javítottunk” valóban, ám nem az Ő munkáját: a növény nemesítésekkel, az állatok háziasításával mindössze a dolgunkat végeztük. “Sokasodjatok és hajtsátok uralmatok alá a földet …”de, úgy “uralkodjunk” ahogyan Isten uralkodik rajtunk: az evangéliumban leírtak szerint boldogságot ajándékoz. Ennek az uralomnak hűségben kell történnie, hálás szívvel, és nem az Ő ellenében, “a jó gazda gondosságával”.

    A válaszaid taposóaknáira nem lépek kedves Rui. Csak egyet: a biotermékeket “rossznak” tartod? Fel kell lapozni a tudományos vizsgálatokat. Volt egy tárolási probléma valamikor, fuzárium fertőzést kapott a gabona, ez jól fel lett fújva, felkapta a sajtó.

    Megsúgom, Oroszországban büntetik a mérget előállító növények termesztését: GMO-kerekasztalnál hallottam, kb két éve, privátban nevet/címet mondok de nem nyilvánosan. Ez itt persze nem politikai fórum, csak megjegyeztem. És valószínűleg, nem fogod megkérdezni.

    A bioélelmiszer ártó mivoltához hasonlóan, szerinted pártolom a BETEGSÉGET hiszen azt írtad, hogy szerintem “hagyjuk csak terjedni a feketehimlőt”. Válaszoltam, hogy pont egy válság-helyzetben volt az oltás feltalálója, és ez a küzdelme, kételyei, végül a döntése milyen mély nyomot hagyott bennem. Válaszod: Jenner doktor KÍSÉRLETEZETT egy fogyatékos gyerekkel … meg, hogy a kertész kisfia… Csupa áldozat, amerre csak gondolataim megfordultak … Miért?!

    Mert pejoratív (jó indulattal az) amit FELTÉTELEZEL. Sötét, mint a sötétnek tartott középkor …

    Zárszó helyett küldök Neked egy filmet, ami egy ateista tudósról szól, különböző tudományok művelőivel való beszélgetéséről, miközben szenvedélyesen kereste az igazságot az addig betonbiztosnak gondolt “hitének” ellenében https://www.youtube.com/watch?v=1FfR_3CGI6E
    Én azt hiszem, hogy aki őszintén KERESI az megtalálja.

  • Lima Rui says:

    Kedves Éva!
    „“Javítottunk” valóban, ám nem az Ő munkáját: a növény nemesítésekkel, az állatok háziasításával mindössze a dolgunkat végeztük. “Sokasodjatok és hajtsátok uralmatok alá a földet …”” Igen, mi is úgy neveljük megfelelően a gyermekeinket, ha önállóságra tanítjuk, az tölt el minket büszkeséggel, ha megállnak a lábukon. Ha nem így lenne, Isten sem csirkét teremtett volna, hanem grillcsirkét 🙂 A kérdést nem provokációnak szántam, csupán gyakran érzem úgy, hogy sok GMO-ellenesnél az az érv, hogy ezzel beavatkozunk Isten vagy bármely isten vagy az Anyatermészet teremtésébe. A legtöbb GMO valóban a nemesítés egy formája (így nem is értem, hogy miért tiltakozol ellenük, ha maga a nemesítés az Istenednek tetsző cselekedet), de a fotoszintézis szuboptimális lépcsőfokainak feljavítása szerintem ezen már túlmutat. A vadalma vagy bármelyik ősi faj jó volt olyannak, amilyen volt, az ember csupán átformálta, hogy számára még jobb legyen. Valójában a nemesített alma sokat veszít a lédús gyümölcsöktől roskadozó ágain, de az ember ezt pótolja öntözéssel, tápozással (és permettel). A vackornak jobb volt úgy, ahogy volt. Hogy kevésbé hatékonyak a fotoszintézis egyes lépései, ráadásul hogy ezek feljavíthatóak az ember által, az egy nem éppen logikus módja a fotoszintézis korlátozásának. Lehetne akkor már kevesebb klorofill, vagy napfény.
    „a biotermékeket “rossznak” tartod” Nem, én is eszem néha. Átverésnek tartom. Valójában nem megvalósítható a bio mezőgazdaság, főleg nagy méretekben: használnak permetet, pl élő Bacillus thuringiensis-t, melynek toxinját termeli a GM kukorica is, vagy rézgálicot. Használnak foszforvegyületeket, melyeket bányásznak, de nem hívják műtrágyának. A földet hamarabb kimerítik, mint a hagyományos mezőgazdaság. A termékeik tele vannak méreganyaggal, de a májunknak aztán mindegy, hogy ezek szintetikusan előállítottak e, vagy gomba- vagy növényi toxinok. Meg van a biomezőgazdaság létjogosultsága, vegye, aki akarja, fizesse ki érte a 3-szoros árat, hisz nem gazdaságos, persze, hogy drágább, de ne terjesszék, hogy ez jobb, mint a hagyományos módszerek vagy hogy felválthatóak azok ezzel. Nem mondom azt, hogy én permetet akarok enni és valóban a cégek abban érdekeltek, hogy a gazdák minél többet vásároljanak tőlük (ez persze minden cégre igaz), így még előnyük is származik belőle, hogy a helytelen permetezés miatt megjelennek a glifozát-rezisztens gyomok, így több permetet kell használni, majd még többet. De a bio az hazugság, hisz a vevő sok esetben nem azt kapja, amit akar, aminek hiszi a terméket, csak ügyes trükközéssel húzzák meg a határokat, de a természet törvényeit nem lehet kikerülni, nincs annyi biomarhatrágya és biokomposzt, hogy azzal fenn lehessen tartani egy fenn-nem tartható területet, ahonnét a rengeteg fogyasztó, az emberek, millió tonnaszámra tolják ki a szerves anyagot, nem bio, vagy egyáltalán fel nem használható formában (szennyvíz, temető).
    A videót köszönöm, majd megnézem.
    dzsaszper: „Megjegyzés: a programozóként fel nem foghatom, a TFBS miért a non-coding kategóriába került, az expresszióvezérlés a programozás lényege, aa magam részéről legalább annyira kódolásnak látom, mint az expressziót magát” Ezek is határok, amiket az ember húz. Persze a kód-kodon-antikodon kapcsolatról van szó. A TFBS-t alkotó nukleotidokról nem íródik RNS, nem transzlálódik, csupán a kódoló szakasz térbeli és időbeli kifejeződését irányítják. Persze ez is egyfajta kód, de itt nyilvánvalóbb a molekulák közötti kapcsolat, mely a molekulák struktúrájából adódik, a TFBS nem csak ad hoc kódol egy aminosavat (persze a tripletek sem), hanem a szerkezete miatt kötődik hozzá a TF, de ezt már próbáltam kifejteni túl sok mondatban. Meg ennek történeti okai is vannak. De ezeket bizonyára tudod és inkább költői kérdés volt.
    Veszt: „a baraminológia mellett nagyon erős érv az hogy 100-200 millió éves leletekben talált élőlények ugyanúgy néznek ki mint a maiak, mintha nem lenne evolúció” Itt mire gondolsz? Gondolom nem a dínókra, Archaeopteryxre, fogas madarakra, emlősszerű-őshüllőkre, zsurlófákra. Ha lenne kambriumi nyúl, az bizonyítaná, hogy az evolúció téves.
    Az általad linkelt cikkben nagy hiba, hogy egyes evolucionista tudósok állításainak megcáfolása (junk DNA) jelentené azt, hogy a baraminológia helyes. „It also further weakens the evolutionary ‘junk DNA hypothesis’ and the ‘genocentric’ notion that only genes are fundamental in the expression of phenotype.” Itt a szerző hamisan állít dolgokat és azt cáfolja. Egykor valóban ez volt az álláspont: „the ‘genocentric’ notion that only genes are fundamental in the expression of phenotype.”, de a cikk írásakor ez egy rég meghaladott nézet volt. Ezzel csak az olvasóit téveszti meg, akik nem járatosak a témában, de elhiszik, amit a szerző állít. De ha ez igaz is lenne (ami nem az, hisz junk DNA bőven van, még ha nem is 90%, illetve a mondat második része, amit az előbb kifejtettem, az ordító hazugság), akkor sem cáfolja az evolúciót és nem erősíti a baraminológiát. Igaz, ezeket a szerző nem is állította, csak éreztette. „The second paradigm shift discussed here begins with the idea that the coding sequence of a gene often remains mostly intact, and that morphological and biochemical changes can take place as a result of mutation in the genes’s promoter region.” Ez a paradigma sem igaz, persze, hogy könnyen megcáfol egy olyan állítást, melyet senki sem állít, maximum csak állított valamikor rég. Még ha igaz is lenne minden, amit a szerző állít, az sem bizonyíték a baraminológia mellett, csupán az evolúciós elmélet tévedéseire világítana rá, amire nem is ő jött rá, hanem evolúcionista biológusok, ő csak összegyűjtötte egy szépen megfogalmazott cikkben.
    Háztartási génekről és arról, hogy „The second paradigm shift discussed here begins with the idea that the coding sequence of a gene often remains mostly intact”: Az EPSP-szintáz (EPSPS) aromás aminosavak (triptofán, fenil-alanin, hisztidin) előállításának egyik lépését irányítja, megtalálható növényekben és baktériumokban. A glifozát a növényi változathoz kötődve gátolja azt, így fejti ki herbicid hatását, de a bakteriális változatnál hatástalan, így az a génmódosított növényekben helyettesíti az endogén gént. Tehát a fehérje egyenértékű a szójában és a szalmonelában, hisz utóbbi enzime helyettesíti az előbbit, az egyezőségük aminosav szinten csupán 52%. Miért különböznek, ha ugyanaz a szerepük? Avagy szerintetek: miért ne különbözhetnének? A kukorica EPSPS 53%-ban, a lucerna EPSPS 52%-ban identikus a szalmonella EPSPS-el. A kétszikű szója és lucerna (mindkettő hüvelyes, bár az utóbbi IRLC, míg előbbi nem) EPSPS-e 87%-ban egyezik, míg az egyszikű kukoricáé mindkettővel 83%-ban egyezik. A hasonlóság mértéke tükrözi a kladisztikai kapcsolatukat egymással és bármennyi tetszőleges fajt ideilleszthetnék. Ha a szója és lucerna származhat egy ősi baraminológiai nemből, de a többi faj független, akkor miért ez a megtévesztő hasonlóság? Át akarja verni valaki a biológusokat? És ez persze nem csak erre az egy génre igaz, hanem az összesre. Konvergencia és horizontális géntranszfer persze kozmetikázhatja, de egyértelmű a hasonlóság mértéke, mely hasonlóság minden egyes génnél megfigyelhető, összhangban az anatómiai jellegzetességekkel és a kladisztikával, mely részben ezeken alapul, de sokszor független, ezeket megelőző felismerésekre épít. Az EPSPS egy konzervált funkciójú háztartási gén. Erős szelekció hiányában mindegyik fajban megközelítőleg ugyanolyan sebességgel ketyegett a molekuláris óra, ezért különböznek ugyanannyira a növényiek a bakteriálistól, illetve a kétszikűek az egyszikűtől. A szója és a lucerna pont ugyanolyan távol van a kukoricától, hisz a közös ősük őse vált el a kukorica ősétől (persze itt az egyszikűek és kétszikűek őséről van szó), és miután ők szétváltak ugyanannyi idő telt el a jelenig (természetesen), így egyezik egymással a 2 hüvelyes 87%-ban, a kukoricával mindketten 83%-ban.

  • Éva says:

    Rui, már régóta offolunk, de azt látom/azért írok, hogy némileg közelednek/közeledjenek az álláspontok: a környezeti állapot, melyet elrontottunk, éppen Istentől való megbízásunk miatt, Neki való elszámolásunk miatt rendkívül fontos. Szerintem SENKI ezt ki nem hagyhatja hogy erről tudjon, ezzel kapcsolatban állást foglaljon és ne “védjen” mert a természetet nem kell megvédeni – mondta prof.Vida Gábor – hanem megismerje azt a jó gyakorlatot, melyben nem a környezet a fontos, hanem mi magunk (és emellett a számonkérésünk ez ügyben).
    Sajnos, hibás a megközelítés és a politikai gyakorlat is, melyben csak büntetésekről eshet szó, melyeket sokszor nem lehet behajtani és pénzben nem is lehet “behajtani” a természeti állapotok súlyos romlását.
    1962-ben a Néma tavasz rázta fel a világ értelmes közvéleményét de több mint fél évszázad elmúltával a helyzet még rosszabb. Prof Borhidi Attila erősített meg egy erdőkonferencián – “csak” megfigyelőként láttam hogy egy nagy hőmérséklet-ingadozás után ősszel kinyíltak majd elfagytak a rügyek és ezek a következő tavasszal nem hajtottak ki. A budai erkélyen másik évben kinyílt egy kevés (nem mind) virág az aranyeső bokromon, kb két éve augusztus legvégén akácillat terjengett az Alföldön, amikor átutaztam ott … Borhidi prof.úr azt mondta, hogy nem csak silent springről van már szó, hanem a silent wood is közeledik: mit fogunk szólni ha egyre kevesebb rügy hajt majd ki (természetesen meg lehet őt erről kérdezni) a mesterséges erdeink és általában a biodiervzitás csökkenés eredményeként de éppen tegnap érkezett http://greenfo.hu/hirek/2017/02/24/vilagszerte-csendbe-burkolozik-a-termeszet

    Nem is “biogazdaságról” beszélnék, hanem ökológiai gazdaságról, ahol a természet végzi el a dolgát mint már küldtem Gyulai Iván kertjéről videót: minél kisebb a parcella, és minél természetközelibb, annál többet terem, ezt Masanobu Fukuoka munkássága fényesen bizonyítja http://wetiko.hu/2011/10/a-sivatag-zolditese/ de érdemes elolvasni a másik cikket innen http://wetiko.hu/2011/10/az-emberisegnek-fogalma-sincs-a-termeszetrol/ és a néhány hsz-is mert az is hozzátesz a mi vitánkhoz.
    A nagy kérdés, a termés mennyisége is bizonyított a permakultúra, a közösségi mezőgazdálkodás, stb. által, a hatalmas monokultúrákkal szemben.
    Ami pedig a piaci kérdéseket illeti, magam ismerőstől veszem a zöldséget, nem is nagyon drágább (a biopiac elszállt áraihoz képest, és nem is bíznék meg bennük) szintén ismerőstől (vezető személyiségtől)kérdezték, “biokertészek” hogy szabad-e már permetezni? Háááát ha itt tart … akkor elkerülöm azokat a piacokat. Az asszony, akitől vásárolok, csak annyit mond “mi nem permetezünk”.
    Alwin Seifert (Kertészkedés “mérgek” nélkül)c. könyvében leírja az eredményeit: akkor, amikor a szomszéd kertben burgonyavész pusztított.
    A természettel való gazdálkodás őnála nem “engedélyezett permetszerekkel” történt, hanem gondolkozással, pl. átültetett egy növényt, melyet elleptek a levéltetvek, Nem a rovarölőszerhez nyúlt, hanem gondolkozott azon, hogy mi történhetett. Az átültetés egy sokkal több nedvességet élvező helyről történt (ereszcsatorna volt a közelben) és próbaként sok vizet adott a növényben. A levéltetvek eltűntek. Ez nem azt jelenti, hogy a levéltetvek ellen vízzel kell védekezni hanem azt, hogy ha hiányt szenved egy növény, legyengül, és megtámadják a kártevők. Ezért a talajélet erősítését, a komposzt-készítést szorgalmazta, majd a talajtakarást, melyben Gyulai Iván (egy tudományos értelemben “sarlatán” asszony gyakorlata alapján) kidolgozta a mélymulcsos művelést, melyben nem kell öntözni, nem kell még komposztot sem készíteni, nem kell talajt forgatni (ennek nem zárójelben kellene lenni hanem csupa nagybetűvel írva)melynek következtében NEM kerülnek üvegházhatású gázok a légkörbe …egyszóval, megvan a jó gyakorlat, ha újra a “kályhától” kezdjük https://www.youtube.com/watch?v=wkwD9gmcG2Q (ez egy nagy film, M.Fukuoka Indiában és sok más helyen Ázsiában, angol)

    A termésmennyiség tekintetében itt egy 400 nm-es városi kert http://utajovobe.eu/hirek/elelmezes/6621-ez-a-varosi-kerteszet-tobb-mint-ket-tonna-elelmiszert-termel-minden-evben: innen terjed majd a tudás a “kiürülő vidékre” ahol már kiskert sincs a falvakban (de van bevásárló-központ), csak tuja meg fű: amikor valaki már nagyobb kertre vágyik a városból – pl.gyümölcsösre – és újra benépesülhetne a vidék … ja, hogy munkaigényes ez a termelési mód (a Jövő farmja szerint nem nagyon, Gyulai Iván is “emberkímélő kertészetről” beszél) a fenti példában örömet adó kézi munka van, DE tömegek válnak munkanélkülivé (ne soroljuk az okokat) és fiatalok milliói akár Európában is, nem találnak munkát …

    Szóval, és ezzel be is fejeztem, ez egy “másik világ” kedves Rui mint a laboratóriumok, viszont visszaköszön – melengetve a szívünket – amit az Úr mondott a teremtés befejezésével: “és látta Isten, hogy amit alkotott IGEN JÓ 🙂 “

  • Veszt says:

    Szia!

    “Itt mire gondolsz? Gondolom nem a dínókra, Archaeopteryxre, fogas madarakra, emlősszerű-őshüllőkre, zsurlófákra. Ha lenne kambriumi nyúl, az bizonyítaná, hogy az evolúció téves.” Pontosan, fogakkal rendelkező madarak, hüllők vannak amik ma is úgy néznek ki mint a fosszíliákban találtak. Ha lenne kambriumi nyúl, akkor biztos keresnél kambriumi pockot is, hogy ragaszkodj a feltevésedhez, de ez már csak így megy az evolúció táján, ha találnak egy leletet ami nem illik az eddigi felvetésükbe akkor tolnak egyet és ha eddig úgy volt hogy a nyúl őse 20 millió éve jelent meg, akkor most már 70 millió évnél lesz. Ezzel semmi gondom, mert az elméletbe illeszkedik, hogy a leletek szabják meg az időegyenest, csak hát így azt a kritikát is semmisé teszi ami éppen a modern, evolúció által létrehozott ‘új’ fajokat hiányolja. De jobban végig gondolva még ezen kívül lehet más oka is, hogy az új fajok annyira nem is újak, de az nyilván tudománytalan.

    A vita, hogy most Mátyás cikke a baraminológiát erősíti vagy az evolúciót cáfolja számomra mellékes, inkább arra mutat rá, hogy mégse olyan “tény” az evolúció ahogy azt állítják és ezzel semmi gond, nem dől össze a világ ha mégse úgy igaz. Számomra sokkal fontosabb hogy a tények és adatok határozzák meg az elméletet és ne fordítva és sajnos valahol egyetértve Ádámmal azt látom, hogy az evolúció elmélet miatt olyan prekoncepcióval dolgozik sok biológus, hogy nem is tud az evolúciótól elvonatkoztatni, holott az eredmények alapján el lehetne és talán előbbre juthatnánk. De ha már annyit elértünk mit amit te is írtál, hogy az evolúció biológusok rájönnek tévedéseikre már az is jó 🙂 A lényeg számomra, hogy van az evolúción is túl élet 🙂 És nem a hitem miatt, hanem a tények és adatok miatt.

    Az EPSPS-re térve: A hasonlóság és az eltérés semmivel sem igazolja az evolúciót. Innen kezdődik a magyarázás, hogy ha már hasonlít akkor biztos származnia kell egy közös ősből. De miért is? Hasonló funkciójú az enzim, persze hogy hasonlítania kell és hogy baktériumban jobban másabb mint a növényekben nem feltétlen a molekuláris óra ketyegését mutatja, hanem a két élőlény különbözősége, a belső molekuláris környezet más egy baktériumnál és más a növényeknél érthető az 52%-os eltérés. A kétszikű és egyszikű (pláne C4-es növények) szintén más a molekuláris környezet ami igényli a fehérje megfelelő felépítését. És bármennyire is szép amit leírtál jó pár taxonómiai kladogramot láttam és ahány labor és ahány féle fehérjét, génszakaszt néztek annyi féle eredmény. Melyik-melyikkel van rokonságban, ki van melyik csoportban közös őssel. A nagyobb (baraminológai) csoportok szépen elválaszthatóak, ott genetikailag is éles különbségek vannak (baktérium, kétszikű, egyszikű – hogy a példádnál maradjak) De utána mikor már családok, nemzetségek jönnek sorra hirtelen elmaszatolódik minden és nem lehet megmondani, hogy ki kinek a rokona, bármennyire is konzervatív, egyenletes molekuláris órákat ketyegtető fehérjéket vizsgálnak. Persze ez ettől még lehet igaz, de nem olyan szép a kép ahogy lefested. Melyik kladogramnak hiszel a sokból?

  • dzsaszper says:

    Kedves Lima Rui, a TFBS kapcsán a kérdésem nem költői volt, legszerencsésebb lenne a kifejezések kapcsán tiszta vizet önteni a pohárba.

    Expresszáló és kódoló nagyon nem ugyanaz!

    A kódolás lényege van az expresszióvezérlésben, expresszióvezérlés nélkül a DNS mint nyelv kifejezőereje durván lecsökkenne, és ha megszűnne a DNS expresszióvezérlése valakinek a szervezetében, nem sokáig élne tovább. Az a minimu, hogy ugen hamar egy rákos daganatnak nézne ki az egész szervezete…

  • Lima Rui says:

    Kedves Éva,
    Ez a városi kert nagyon jól hangzik, csak elég hihetetlen számomra. 2720 kg élelmiszer 400 négyzetméteren 1 év alatt. Itt látható a tavalyi, állítólagos rekordtermés: http://ecolounge.hu/nagyvilag/a-tavalyi-magyar-mezogazdasagi-termes-rekordjait-adta-kozre-a-ksh-jelentese
    Napraforgó 2950 kg/hektár, kukorica 8610 kg/ha. 1 ha pedig 10 ezer négyzetméter, ami 25-ször több mint 400 nm. Tehát a városi gazdaság 8-25-ször többet termelt, mint a magyar gazdák. A gazdák se a maguk ellenségei, a profitért dolgoznak, nem pedig ideológiai okokból, nem vallásuk a hagyományos mezőgazdaság. Eleve ki sem alakult volna a monokultúra és a modern mezőgazdaság, ha a közelébe se érnének egy ilyen kis gazdaságnak. Ez nekem több mint gyanús. Feltételezem Veszt ehhez jobban ért, ő vajon mit mond?
    Amúgy a célunk ugyanaz és ugyanazért aggódunk. Én sem akarok vegyszereket enni és nem szeretném, hogy tönkrevágják a természetet. Kívánom, hogy valóban életképesek legyenek ezek a módszerek, még ha én magam elég valószínűtlennek is tartom azt, hogy működjenek, főleg rosszabb adottságú helyeken, a klímaváltozás által is nehezítve. De igazán nem is értek a mezőgazdasághoz, meg lehet győzni.
    Veszt: „Pontosan, fogakkal rendelkező madarak, hüllők vannak amik ma is úgy néznek ki mint a fosszíliákban találtak.” Van ezekről a mai fogas madarakról link is? „Ha lenne kambriumi nyúl, akkor biztos keresnél kambriumi pockot is,” Elég lenne a nyúl is. Nyílván a Tervező szándékai kifürkészhetetlenek, de 3 milliárd évig vajon miért csak baktériumok és egysejtűek voltak a Földön? És amikor kedve szottyant diverzebbé tenné az élővilágot, akkor miért sorban haladt, egyre összetettebb életformákat létrehozva, többek között egyre fejlettebb idegrendszerrel? Miért előzték meg a kétéltűek, hüllők és emlősszerű hüllők a méhlepényes emlősöket, miért nem találunk a kambriumból pl nyúl leletet? „ha találnak egy leletet ami nem illik az eddigi felvetésükbe akkor tolnak egyet és ha eddig úgy volt hogy a nyúl őse 20 millió éve jelent meg, akkor most már 70 millió évnél lesz.” Persze, ugyanis a tudományokban az elméletet igazítják a tényekhez, nem pedig fordítva. Ha 20 millió éves a legrégebbi nyúl lelet, akkor annak anatómiai sajátságai miatt esetleg feltételezik, hogy az ősibb forma kialakult mondjuk 25-30 millió éve, de ha találnak egy 70 millió éves leletet, akkor az persze mindent átír. Szerinted ennek nem így kéne működnie?
    Mátyás cikke után rákeresve pár kifejezésre, pl a „genocentric evolutionary paradigm”-ra, megerősödtem abban, amit eddig is gondoltam, hogy rég meghaladott nézetekkel viaskodtok. Sőt, leginkább magával Dawkinsal. A genocentrikusságot ugyanis ő vetette fel „Az önző gén” című könyvében 1976-ban. 1976! Majdnem leestem a székemről. Ez majdnem olyan nevetséges, mint a Wistar konferencia. Ráadásul ez nem egy széles körben elfogadott elmélet, sőt, többen támadják, mint nem. A helyes kifejezés inkább „az önző szekvencia” lenne, pl a TFBS-ek miatt, de ide vehetjük a promótereket, sőt a vírus szatelliteket is. 1976 óta sokat fejlődött a biológia, 1976 a genetika hajnala volt. Lehet, hogy Dawkins leragadt a 40 évvel ezelőtti elméleténél, de ő nem az evolúció elmélet egyik (fő) prófétája, még ha az evolúció-tagadók annak is tekintik. Nem meglepő módon Dawkins erős vallásos nevelést kapott, ami nála visszájára sült el. Biztos vagyok benne, hogy az Ádám által linkelt tanulmányban szereplő 5,6%-nyi evolúció-szkeptikus releváns kutató jelentős része, ha nem az összes, vallásos nevelést kapott.
    EPSPS: Mivel a szalmonella fehérje teljes mértékben helyettesíti a szója fehérjét, így valószínűsíthető (sőt, tudott), hogy a funkciót ellátó domén a közös 52%-ban található. Semmi se indokolja az ennél nagyobb hasonlóságot. Mégis, a kladogramon haladva az EPSPS homológiája tükrözi a csoportok (vélt) rokonságát, ahogy az 52% egyre inkább, fokozatosan közelít a 100%-hoz. Ráadásul a különböző elágazásoknál más-más irányba halad mindez, és a csoporton belül más-más szekvencia jellegzetességek alakulnak ki és halmozódnak fel, nem csak fehérje, hanem nukleotid szinten is, az intronok és szabályozó elemek, nem kódoló szakaszok szintjén is. a két 87% nem ugyanaz, az egyik az egyszikűekre, a másik a kétszikűekre jellemző. „Melyik kladogramnak hiszel a sokból?” A kladogram egy ábrázolás, mely minél több mindent próbál figyelembe venni, de mindent nem tud. Kladogramok több, mint 100 éve léteznek, régebbiek, mint maga az evolúciós elmélet, de a teljes genom szekvenálás, csak 10-20 éves technológia és csupán pár 100 fajnál végezték még el, de gyakorlatilag naponta publikálnak friss eredményeket, ami persze, hogy módosítja az eddigieket, hisz a hagyományos rendszerezés az fenotípus alapján történik, de az sokszor félrevezető.
    Az eredeti cikkről: A matematikai tanulmányt a Theoretical Biology and Medical Modelling újság közölte le, a maga 1,033-as impakt faktorával, ami nem vehető túlságosan komolyan, így az általa megjelentetett cikkek sem. Pedig 2004 óta lett volna hová fejlődnie. Kiemelnék egy részt: „Even waiting for the fixation of a single point mutation that converts a specific nucleotide within the genome into a specific alternative nucleotide is problematic. The waiting time for the establishment of such a simple event requires on average over 1.5 million years”Eszerint a nagyrasszok 1 nukleotidban sem különböznek egymástól, hisz a szétválás kb. 60 ezer éve történt, amikor az emberiség egy része elhagyta Afrikát. A kék szemszín se mutáció eredménye, ami 6-10 ezer éve alakult ki és nem is rögzült az emberi populációkban. Vagy mégis? Előfordul még pár millió példa. „This means that the waiting time for a specific nucleotide within a single chromosomal lineage would be 100 million generations. In a diploid population of 10,000 there are 20,000 copies of each nucleotide, so in such a population the waiting time to first mutation would be 20,000 – fold less (5,000 generations). But to have that specific nucleotide mutate into a specific alternative nucleotide (there are three alternatives), takes three times more time – which is 15 thousand generations. But even if the mutation is highly beneficial, on average it has to happen very roughly ten times (given the 10 % fitness benefit), before it “catches hold”. This yields 150,000 generations. Assuming a generation time of 20 years, the waiting time is about three million years.” Hát ez meg mekkora baromság? Ha minden generációban 1 szem ember születne, akkor esetleg így is lehetne. Majdnem akkora sületlenség, mint az az állítás, hogy egy mutációnak 10-szer is ki kell alakulnia, hogy rögzüljön. Miért is kéne így lennie? Kilencszer rádől a mutánsokra a fa mielőtt gyereket csinálnának? Az első kilenc kékszeműt agyonverték, mire a tizedik megtetszett a csajoknak, így gyorsan el tudott terjedni? Hopp, ez nem lehetett így, hisz ez 3 millió év alatt fordulhatott volna csak elő, így maximum csak kékszemű Australopithecusok létezhetnének. (Nem mintha közük lenne az emberekhez, nem igaz?)
    Wistar konferencia (csupán Ádám leírására hagyatkozva): „Na most egyetlen egyszerű – mondjuk 150 aminosavból álló – fehérje adott kombinációban való megépülésének valószínűsége kb. 10^195, ami nagyságrendekkel nagyobb szám, mint amennyi becsült elektron van az egész univerzumban!” Lehet, hogy az adott fehérje nem alakul ki, de egy másik adott fehérje kialakul. Minden egyes fehérje kialakulásának (matematikailag) ugyanannyi az esélye, szóval minden egyes fehérje 10^195 eséllyel alakul ki. A gondolatmeneted alapján egy fehérje se alakulhatna ki, úgy megijednének a 10^195 lehetőségtől. Ráadásul a kémia nem matek. Melyik aminosavból mennyi van a kiindulásnál? Mennyi az össz-aminosav szám? Melyik mennyire stabil? Egyáltalán a kialakult fehérjék mennyire stabilak? Milyen volt a környezet? Milyen fehérjebontó vagy épp fehérje-stabilizáló vegyületek voltak jelen? Kisebb fehérjeláncok is kialakulhatnak, ahol a stabilabbak dominálnak, így jelentősen lecsökken a variációk száma. Ki mondta, hogy az első fehérjéket, az első élőlényeket mind a 20 aminosav alkotta?
    dzsaszper: https://hu.wikipedia.org/wiki/K%C3%B3d_(informatika) . „A kommunikációban kód alatt egy transzformációt értünk, ami információk bizonyos egységét (például egy betű, szó, vagy kifejezés) átalakít más formába vagy megjelenésbe, nem szükségszerűen azonos típusúba.” A linken jobb oldalt látható a Morse kód. Pontok és vonalak alkotják a kódot, de értelmetlenek, ha nincs az emberi agy, amelyik értelmezi. És az emberi agy alkotta meg eleve, és erre az analógiára fűzitek fel az értelmes tervezést is. Hasonló karakterek léteznek spontán is a természetben, mindenbe belelátható hasonló kód, attól még nem lesz értelmük, nem igaz?. Vagy mégis? Mi ad a kódnak értelmet? Ezer majom ütheti a klaviatúrát és akár leírhatnak egy gyönyörű verset ezer év alatt, de ha nincs aki értelmezze, akkor az ugyanúgy nem jelent semmit, mint az első katyvasz soruk: GSHJKIODPOFLPIRHIENDDKMÉODK)DH. De mi van, ha az értelmezéshez nem kell intelligens elme? Ha nem egy versről van szó? A versnek vannak betűi, el lehet szavalni, van üzenete, tükröz egy érzést, érzelmeket vált ki. Ezek mind valóságosak, de maga a vers egy fogalom. A majom le tudja írni, hogy ENZIM, attól az még nem fog működni, nem fog reakciót katalizálni. Ha kialakul spontán egy transzlációs rendszer, akkor az előbb-utóbb le tudja írni, hogy enzim, de az az enzim, az a fehérje már működni is fog és reakciókat katalizál, aminek ha van értelme, akkor rögzülhet. Mi van, ha a nukleotidokhoz eleve kapcsolva van az aminosav? HA az E betűre rá van kötve a struktúra, az N-re X vegyület felismerése, Z-re Y elem felismerése, I-re a kettő összekapcsolása? M később is rárakódhat, új funkciókat hozzáadva a rendszerhez. Ha az ENZIM hasznos funkciót lát el, akkor a nukleotidok is és újabbak csatlakozhatnak hozzájuk.
    „a programozóként fel nem foghatom, a TFBS miért a non-coding kategóriába került, az expresszióvezérlés a programozás lényege, aa magam részéről legalább annyira kódolásnak látom, mint az expressziót magát” A két rendszer teljesen külön van választva. Az expresszió a transzkripció, a kódolás meg a transzláció, a két rendszernek kevés köze van egymáshoz. 4 milliárd év evolúció után (persze ha létezik) minden élőlényben magasan fejlett mindkettő, de alapszinten (és ilyen most is létezik) az expresszió-szabályzás annyiban merülhetett ki, hogy adott génből hány kópia van. Egységnyi génről egységi idő alatt egységnyi fehérje készül. Nem túl bonyolult rendszer. Egy pozitív szálú RNS vírus a sejtbe bejutva, a kapszidtól megszabadulva, gyakorlatilag egy hosszú mRNS. A készülő fehérjék mennyiségét csupán a sejtbe bejutott vírus RNS mennyisége határozza meg (később persze kell az RNS-függő RNS-polimeráz, illetve a promóterek, amiket felismer). Az expresszivezérléshez nem kell Tervező, csupán nukleotidláncok spontán kialakulására van szükség, ami viszont lehetséges. Az RNS-nek, mint ribozimnek önmagában is lehet funkciója, így itt kódról sincs szó valójában. A transzláció maga a kódolás, aminek a lényegi részei a tRNS-ek. A tRNS-ek kötik össze a megfelelő aminosavat a megfelelő RNS nukleotid triplettel, a tRNS molekulák az értelmezők. Ez az értelmezés csupán egy kémiai reakció, önmagában szintén nem értelmes, hisz X (RNS nukleotid) és Y (aminosav) molekula között teremt kapcsolatot. A sok aminosav molekula, a fehérje, viszont már tud értelmes feladatot ellátni. Ezt a feladatot az aminosav sorrend és aminosavak struktúrája határozza meg. Ez utóbbi nem része a kódnak. A funkciónak, a kódolás lényegének, csupán egy részét adja maga a kód, az aminosav sorrendet, mely viszont spontán is létrejöhet. A 10^195 lehetőségnek az elsöprő többsége ellát valamilyen funkciót, hisz az egyes aminosavak önmagukban bírnak tulajdonsággal, mely funkciót vehet fel, részt vehetnek reakciókban. Lehet, hogy a 150 aminosavból csak 5 látja el az élőlény számára szükséges funkciót (domén), csak annak kell kialakulnia, a többi 145 csak ne gátolja. Persze az első replikonban (hisz ezek még az első élőlények előtt létrejöhettek) ez a 145 nincs meg, csak pár belőle, melyek később rakódnak rá és akár további előnyt is jelenthetnek. „A kódolás lényege van az expresszióvezérlésben, expresszióvezérlés nélkül a DNS mint nyelv kifejezőereje durván lecsökkenne, és ha megszűnne a DNS expresszióvezérlése valakinek a szervezetében, nem sokáig élne tovább. Az a minimu, hogy ugen hamar egy rákos daganatnak nézne ki az egész szervezete…” Valóban. Az első élőlények nem rendelkeztek akkora komplexitással, mint az ember, ugye. Egy Tervezőnek mondjuk ez nem lett volna akadály, de ne firtassuk, miért nem rögtön embert tervezett, hisz erre nem is lehet válasz. (Bár elgondolkodtató. Ha nem is elsőre teremtenék embert, nem várnék rá közel 4 milliárd évet. Persze ha isteni hatalommal bírnék, az idő se számítana. De értelme akkor sincs.) Egy protosejtnek viszont, sőt egy annál is primitívebb replikonnak ez előny is lehet, hisz ha korlátlanul elburjánzik, akkor az erőforrásokat is nagyobb előnnyel hasznosítja és dominanciára tehet szert. Ez önmagában előny. Persze az erőforrásuk egy idő után kimerülnek, újak felderítésére egyéb előnyökre is szükség van, melyek mutációk révén tudnak kialakulni. Előnyös replikonok egyesülni is tudnak, még több előnyre téve szert.

  • Éva says:

    Kedves Rui, ezért érdemes volt “offolnunk” ami csak azért történt,mert megkérdezted,hogy mit tudok én egyáltalán a mezőgazdaságról. Nagyon örülök hogy felszállt a füst 🙂 és akkor hozom a linket arról a kis füzetről, ami anno engem is meglepett, de hát a németek nagyon tudnak, minél kisebb a terület, annál jobban megbecsülik http://www.ahely.hu/domb%C3%A1gy%C3%A1sos-kertm%C5%B1vel%C3%A9s-csal%C3%A1dell%C3%A1t%C3%A1s-25nm-r%C5%91l-c2133 Ezt úgy kell elképzelni, hogy mindig ott vannak, külön palackokat dugdosnak a földbe,mert szárad … Tulajdonképpen egy alap-komposzthalomra halmoznak nagyon termőképes, humusszal jól ellátott réteget, és míg ez a komposzthalom beérik, egyre jobban terem közben 🙂 a domb magassága eltűnik. Tehát ezzel csak azt akartam mondani, hogy minél belterjesebb egy termesztés, annál több lehet a termés.
    Szivem csücske a mélymulcs, de már írtam, 60 cm-es szalmarétegből ősszel már alig volt valami (a talpunk alatt).
    Egy másik rendszerben a vásárló-termelő együttműködéssel http://tudatosvasarlo.hu/cikk/mukodo-kozossegi-mezogazdasagi-csoportok-bevasarlokozossegek hihetetlen eredményeket hallottam (egy képzésen) 2,5 család ellátva egyetlen házikertből, aztán + 1000 nm-ről még négy. A pálmát tényleg a domboságy viszi, azért is kezdtem azzal.El kell MAJD búcsúzni a “mező”-gazdaságtól … nagy átalakulások jönnek REMÉLJÜK.
    A nagy cégek – Monsanto meg a többi – viszont nem ebben érdekeltek 🙁

  • Szabados Ádám says:

    Lima Rui,

    A genocentrikusságot ugyanis ő vetette fel „Az önző gén” című könyvében 1976-ban.

    Hát J. Maynard Smith és a molekuláris biológia „központi dogmája”? Ha a genocentrikusság csak Dawkins meg néhány lemaradt neo-darwinista fixa ideája, akkor miért támadják még mindig a Third Way híveit, ők pedig miért érzik magukat még mindig különutasoknak? Abban viszont egyetértünk, hogy a (géncentrikus) neo-darwinizmus meghaladott (vagy megbukott) elmélet.

    Ez majdnem olyan nevetséges, mint a Wistar konferencia.

    ???

    Minden egyes fehérje kialakulásának (matematikailag) ugyanannyi az esélye, szóval minden egyes fehérje 10^195 eséllyel alakul ki. A gondolatmeneted alapján egy fehérje se alakulhatna ki, úgy megijednének a 10^195 lehetőségtől.

    Azért alakulnak ki a fehérjék, mert ott van a kód. Az információ, amely az aminosavak sorrendjét és a fehérjék összeszerelését meghatározza. Akkor merül fel a döbbenetesen kicsi (10^195) probabilitás, ha a kód véletlen kialakulását feltételezzük. Az epigenetikai információról szerzett ismereteink óta a valószínűség problémája csak hatványozottan megnövekedett.

    Mi van, ha a nukleotidokhoz eleve kapcsolva van az aminosav?

    Eleve?

    Egységnyi génről egységi idő alatt egységnyi fehérje készül. Nem túl bonyolult rendszer.

    ???

    Az expresszivezérléshez nem kell Tervező, csupán nukleotidláncok spontán kialakulására van szükség, ami viszont lehetséges.

    ???

    Egy Tervezőnek mondjuk ez nem lett volna akadály, de ne firtassuk, miért nem rögtön embert tervezett, hisz erre nem is lehet válasz. (Bár elgondolkodtató. Ha nem is elsőre teremtenék embert, nem várnék rá közel 4 milliárd évet. Persze ha isteni hatalommal bírnék, az idő se számítana. De értelme akkor sincs.)

    ???

  • dzsaszper says:

    Kedves Lima Rui,

    tömören, a lényegre reagálva:

    te a DNS kódja esetében a DNS bázisszekvenciáit tekinted csak bemenő információnak, míg én mindenféle (többé-kevésbé) környezeti hatást is, ami a genom különböző részeit aktiválja: onnantók, hogy éhezik-e az alanyunk, a külső hőmérsékleten át addig, hogy van-e szükség immunkreakcióra, a mindenféle hormonális jelzéseken keresztül nagyon nagyon sokféle bemenet van — amire a választ kódolni kell — egy valamire való élőlénynek kell tudnia reagálnia a külső hatásokra, ha nem akar kiszelektálódni.
    A DNS Neumann-elvű tárolt programkód leginkább, és a Neumann elv épp arról szól, hogy a programkód tartalmazza mind a transzkripciós mind a transzlációs utasításokat tartalmazza… Nem különül el a kettő, hanem keveredik!

    A majmos példáddal meg kb. ismétled a korábbi érveimet. Ahhoz, hogy egy jelsorozatnak értelme legyen, ahhoz (leginkább már a jelsorozat létejöttekor) meg kell legyen az a kontextus, amiben értelmezni lehet, — kell egy értelmi szerző aki az adott kontextusban értelmezhető módon fejez ki jelentést — a lyukkártyához az értemi szerzőnek ismernie kell a lyukkáryták értelnezését stb.

    A kezdeti expresszióvezérléssel kapcsolatban meg maradjunk annyiban, hogy nem szoftverrel foglalkozol. Láttál már gépi kódod vagy assembly kódot?

    Korábbi megjegyzésedet Isten munkájának kijavításával kapcsolatban meg gondolkoztam, hogy értelmezzem. Nézd körül a földön, akárcsak a talajfogyást amit a műtrágyával csinálunk… sok-sok mindent “kijavítottunk” már, de utólag csak az derül ki, hogy csak elrontottuk…

  • dzsaszper says:

    Ádám, jól látom, hogy Lima Rui egy blogmotoron elakadt hozzászólásra reagáltál?
    Nem találom sehol azt amire reagáltál…

  • Szabados Ádám says:

    Ott van feljebb a hozzászólása, amire reagáltam.

  • dzsaszper says:

    Bocs, most látom hogy egy typo miatt nem találtam az oldalon az egyik idézett mondatot.

  • dzsaszper says:

    Az expresszivezérléshez nem kell Tervező, csupán nukleotidláncok spontán kialakulására van szükség, ami viszont lehetséges.

    Az expresszióvezérléshez először is egy olyan kontextus kell, ami a DNS egy szeletkéjét aktiválni, deaktiválni tudja, pl. transzkripciós faktorokra. Meg kell egy szervezet, aki a transzkripciós faktorokon keresztül vezérelni tudja a fehérjeszintézist. Hiába alakulnak ki nukleotidláncok, transzkripciós faktorok, miegymás nélkül nem lesz expresszióvezérlés.

    Mindezt már nagy valószinűséggel egy valamire való prokariótának is tudnia kell 🙂

  • Szabados Ádám says:

    dzsaszper,

    ez szerintem érdekelhet téged.

  • dzsaszper says:

    Érdekes bionikai eredmény az információtechnológia területén 🙂

    A cikk témájában sokkal inkább a genom lingvisztikai elemzése érdekel, a sgenom szemantikájának felfedése apránként. A TFBS-ek szerepe például egy lépés ebbe az irányba.

  • Veszt says:

    Sziasztok!
    Lima Rui: A hoacin-ra gondoltam a madaraknál, ami nagy hasonlóságot mutat az Archeopterix-re, igaz hogy fogai nincsenek, ebben tévedtem, de rémlett valami a fogakkal rendelkező madarakról, de rosszul emlékeztem, a hoacin-nek nincsenek fogai. A Tervező szándékai nem kifürkészhetetlenek, csak te nem akarsz róla tudomást venni, a kettő között van különbség. És pont a kladogrammok is azt mutatják, hogy nem sorban haladt, miért él ma is olyan élőlény ami az evolúció rendszere szerint “elavult” rendszerrel rendelkezik? Ha a többsejtűség előny miért élnek egysejtűek? Ha a gerincesség annyival jobb mint a gerinctelenség, akkor azok miért maradtak életben? Vagy a fejlett idegrendszer hol jelent előnyt egy fejletlennel szemben? Vagy az újszájúak és ősszájúak? Vagy mégsem működik a szelekció aminek hajtania kellene az evolúciót? Talán nincs is evolúció…
    És nem az a gondom hogy egy faj 20 vagy 70 millió éve jött létre és akkor húznak egyet a skálán, hanem magának az evolúciós elmélet alapproblémájával nem foglalkoznak, hogy ha a szelekció és mutáció nem képes meghajtani az evolúciót akkor az miért is működne?
    Abban egyetértek, hogy Dawkins is csak kapisgálja a tudományt, de mivel ő úgymond a reklámarca, zászlóshajója az evolúció elméletének a médiában, így akik a teremtés pártiak őrá reagálnak. A tudományos élet persze megy előre és azt gondolom hogy aki az evolúciót vagy a teremtést kutatja annak a laborban és a terepen van a helye, ott kell a “harcot” megvívni.
    Én is úgy gondolom hogy a DNS szekvencia alapú kladogrammokra mint evolúció bizonyítékai és azokra hiteles törzsfát építeni valóban még egyelőre bizonytalan, illetve még éppen annyira biztos csak mint a baraminológia elméletét építeni. Ahogy a baraminok jól elválaszthatóak DNS szekvenciák alapján éppen olyan jól választhatóak el az evolúciós elmélet által jól meghatározott taxon szétválások (linkek nélkül, mert azokat nem találják meg…).
    “De mi van, ha az értelmezéshez nem kell intelligens elme?” – szerintem itt van amit a kezdetek óta félreértesz, a teremtés pártiak nem azt mondják, hogy a szekvencia olvasásához kell intelligens elme, hanem az egész rendszert intelligencia hozta létre. A rendszer, hogy DNS-RNS-Fehérje, az önreprodukció maga nem jöhetett létre magától, mi ezt mondjuk és nem azt hogy a fehérjéknek IQ-ja van. Persze hogy nincs, persze hogy az enzimek maguktól működnek, csak legyen szubsztrát. Az egészben a csoda az élet felépítése, a rendszer, hogy van információ ami kódolt formában az életet tárolja és tovább adja. Kémián és fizikán keresztül valósul meg, de mégse kémia és fizika, mert az nem hozhatta létre a rendszert.

    Az Évával folytatott beszélgetésetekre reagálva az USA-ban 1 hektárról 32 tonna kukorica volt lehozható, ami majdnem fele az Éva által írtnak és a kukorica csak májustól októberig van a szántóföldön… De amit itt tudni kell és lehet Éva se vesz figyelembe, hogy mekkora munka és energia ráfordítást jelent egy ekkora termés. Sokan a számítógép mellett ülve el se tudják gondolni mennyi minden kell a magas terméshez, mennyi munka van egy bio vagy akár nem bio területtel. Ami eddig is megmutatkozott hogy az ökológiai gazdálkodás rendkívül energia igényes folyamat, nagyon nagy az élőmunka igénye és a nagy terméshez nagyon nagy mennyiségű víz, szerves és szervetlen tápanyag kell. Nem véletlen hogy a nem biogazdálkodás az elterjedt mert úgymond a ráfordítás megtérülés itt a legkisebb, biogazdálkodásban sokkal nagyobb ráfordítás kell ugyanakkora terméshez és hát ezért is annyival drágábbak a bioélelmiszerek.

  • Éva says:

    Kedves Veszt, egyrészt dehogynem veszem figyelembe,pl. a domboságynál – kimondottan kis területen – állandóan figyelik, hol szabadul fel hely és azonnal vetnek vagy ültetnek oda.
    Fukuoka összes eredményét nem ismerem, de ő maga mondja, hogy amit termésátlagainál nagyobbat nem tudnak ott felmutatni, viszont azt is mondja, hogy “ehhez a gabonához a termésátlagoknak semmi köze” 🙂 ez egy kitűnő mondat csak sajnos le kell fordítani. Azt jelenti, hogy nem jövedelmezőségről van szó, hanem természetes gazdálkodásról és a kettő egy lapon sem említhető (előbbi tönkreteszi a talajt/környezetet, a másik meggyógyítja).
    A legjobb amit Gyulai Iván fejlesztett ki, az “Ember- és környezetkímélő gazdálkodás” a mélymulcsos: csodálatosan gyógyítja meg a talajt! DE “A jövő farmja” c. filmben is azt mondja egy kertész, hogy amennyit dolgozik, az max 2 óra hetente, és az is főképp betakarítás.

    Ide egy teljesen megújult gondolkodásra van szükség, nem pedig munkaórák/termésátlagok számítására. A közösségi mezőgazdálkodásban – ahol ismeri egymást a termelő és a vásárló – a kert látogatása élmény főleg a gyerekeknek, de szerintem mindenkinek. A kertésznek is emberi körülményeket jelent, nincs úgy odakötve mint régen a földművesek, például elmehet szabadságra, van, aki helyettesíti … szóval, ez egy másik világ 🙂

  • Veszt says:

    Kedves Éva, ez már nagyon off ide, de remélem te is látod az ellentmondást az írásodban, a jövedelmezőség nem csak a haszonról szól, hanem ahogy írtam a ráfordított energiáról, tápanyagról, élőmunka igényről. Munka nélkül nincs eredmény, csak a mesékben (és MLM rendszer toborzókon), és sokakat szédítenek azzal, hogy munka nélkül is el lehet eredményt érni, de ez nem igaz (olyan számomra ez mint a sátán egy hazugsága, munka nélkül lehet eredmény?). A növényeknek szüksége van a magas terméshez magas tápanyagszintre és nagyon sok gondozásra. És igazad van ez egy más világ, nem a miénk. Többet nem is kívánok hozzászólni ehhez, egy biodinamikus gazdálkodásról szóló ppt megnézve még az is átjött hogy ez egy nagyon okkult terület (link). Azt tudom mondani, hogy próbáld ki, és kívánom hogy sikerüljön, de ebben a világban nem fog. Ne keseredj el, ha heti 2 óránál többet kell majd dolgoznod, hogy tudj enni. Ha ez működne már 1000 éve ez lenne mert az ember nem buta hogyha 8 óra helyett csak 2-t kellene, természetünkből eredően lusták vagyunk 🙂

  • Szabados Ádám says:

    Elképzelésem sincs, hogy jött be ide a biogazdálkodás témája, de tényleg off. Nagyon off.

  • Éva says:

    Úgy jött ide, és bocsánatot kérek az offért, hogy Rui azt írta nekem hogy “fogalmam sincs a mezőgazdaságról”. Ezért, és mert más témákban is felmerült a blogodon az pl hogy “szükségszerű-e a haladás” – ott is másra volt irányítva a kérdés, nem a tudomány egészére – a tisztázás kedvéért a következőket még leírom utólagos engedelmeddel kedves Ádám.

    Veszt, valóban, a biodinamikus erősen hajaz az okkultra, azt messze elkerülöm.

    Most vagy igazat mondott “A jövő farmja” c. filmben a kertész,hogy heti két óra és az főként betakarítás emiatt LÉTEZIK más mód (a filmet indításként vetítették Keszthelyen a Georgikon Karon egy nemzetközi konferencián kb 3 évvel ezelőtt, ősszel) vagy nem … Én inkább a “nézzétek az ég madarait, nem vetnek … a mezők liliomait hogy öltözködnek … ” példabeszédre utalnék. Mert megtaláltuk, és BIZONYÍTANI tudjuk ezzel hogy így van 🙂 nemcsak “lelkiekben”, hitbeli hozzáállással hanem a valóságban. A Teremtőt dicséri mindez 🙂 ezért nem hallgathatok (mert akkor a kövek fognak megszólalni 🙂 )!

    Gyulai Iván ökológus MEGTALÁLTA a megoldást, mégpedig egy “sarlatán” – hozzá-nem-értő (?) asszony gyakorlatából – Ruth kertje, elérhető az interneten – aki elkezdett beszélgetni az aszparáguszokkal amikor nem jöttek felszántani a kertjét: “ti hogy csináljátok” ? Ez ér, ha Assisi Szent Ferenc beszélget(het)ett egy farkassal, eredményül az békén hagyta a falu lakóit … persze, hozzátette, hogy adjanak a farkasnak enni 🙂

    Hogy mennyit kell izzadni ahogy írod kedves Veszt – hozzáteszem, “emberé a munka, Istené az áldás” – azt az “Ember- és környezetkímélő kertművelés” videóban lehet látni. Nem hozom a linket (de már hoztam máskor) Iván kertje címen is megtalálható. A legfontosabb, hogy megértettük, nem a talaj termi a növényt, hanem a növény a talajt – ami ha így megy tovább a nagyüzemi “hagyományos” gazdálkodással, magunkra hagy minket és nem fog teremni de a legfontosabb:

    a (jobbára) méregmentes ennivaló GYÓGYÍT – regenerálja a szervezetet, bizonyított, nagy eredmények vannak melyeket szerintem hűségből kötelességünk megismerni – míg a másik bizony, mérgez vagy “CSAK” nincs benne a táplálék, amelynek “benne kéne lenni”.

    Fenti levelezés bizonyítja, hogy a maguk fogyasztását illetően, Rui is erre tart …

    Ezen a nyomon Istené az ÁLDÁS https://www.youtube.com/watch?v=zg-Lw9lDRY4

  • istván says:

    Kedves Ádám!

    elolvastam a kommenteket, és feltűnt, hogy nagyon alaposan utánanéztél a témának.
    Mégis van egy hiányossága az érvelésednek, ami abból ered, hogy rendszer szinten még nem állt össze a kép. (lehet, hogy igen csak nekem nem jött át)
    Az evolúció hívők soha sem állították, hogy egy fehérje egy kész rendszerhez vagy sejthez fejlődött ki (ez teljesen értelmetlen is lenne. Szerintük az egész együtt fejlődött nagyon egyszerűből nagyon bonyolulttá.
    X fehérje tényleg y valószínűséggel fejlődik olyanná, amilyennek ma ismerjük, és ez tényleg nagyon valószínűtlen, hogy bekövetkezzen. Azonban X fehérje a vele együtt alakuló környezete miatt lett olyan amilyen.
    Ha más lett volna a környezete (a sejten belülire gondolok), akkor x fehérjének bármelyik másik fejlődési alakja is ugyan olyan funkcionális lenne és ez ki is veszi azt a gátat a rendszerből és az elméletből, hogy nagyon valószínűtlen.
    Más szavakkal: egyik molekulának sem kellett a változások során megfelelni annak a környezetnek amelyikben most funkcionál, mert a környezete is azért lett olyan, mert úgy változott az a molekula. Tehát “bármelyik” (persze nem teljesen igaz) változata lehetne ugyanilyen jó, de ennek az egynek ami végül is lett tényleg nagyon kicsi, elhanyagolhatóan kicsi esélye volt, hogy kialakul.

    ahogy korábban is írtam, az evolúció elmélete és az RNS világé is elég jó elmélet (sajnos), logikailag szerintem nem nagyon tudod kikezdeni. a matematikusoknak is meg kellene tanulniuk biológusként látni azt, amihez hozzászólnak, akkor talán jobban tudnának érvelni a valószínűséggel.

    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2519897/
    https://elifesciences.org/content/5/e10147

    ezek az eredmények szintén nem bizonyító erejűek, még mindig az előítéleten múlik az értelmezésük (és persze a filogenetikából indulnak ki), de nagyon jól rávilágítanak arra, hogy a fehérjék milyen kis változtatással képesek teljesen más feladatot ellátni nagyon alapvető és nélkülözhetetlen funkciók esetén is.
    Ha ezt hozzávesszük az egészhez, akkor jelentősen csökken a lehetetlensége annak, hogy anyagi folyamatok értelmes és nagyon fundamentális változásokhoz vezessenek. persze ettől még minden Isten kezébe van; mindig, és valós időben. ezt viszont úgyis csak hit által lehet megérteni.
    (ha nem tudod letölteni a cikkeket, elküldöm e-mailben.)

    Kedves Lima Rui!

    Kérlek olvasd el, János evangéliumát és válaszold meg, hogy kicsoda Jézus (de nem ám zsigerből, szánd rá az időt, mint amikor tudományos elméleteken filózol, előítéletek nélkül). Ha megteszed sokkal élvezetesebb lesz a további vitánk. Ja és ne kommentárokat olvass helyette.
    (ha nem volt túl unalmas, utána elolvashatnád Lukács evangéliumát is)

    a másik:
    kíváncsi vagyok, hogy ezek a cikkek:

    http://www.sciencedirect.com/science/article/pii/S875632821201318X
    http://science.sciencemag.org/content/307/5717/1952

    hogy illenek a világképedbe.

  • Szabados Ádám says:

    Kedves istván,

    szerintem kicsit félreértetted az érveimet. Én sem állítottam, hogy az „evolúció hívők” szerint egy fehérje egy kész rendszerhez vagy sejthez fejlődött ki. Azt állítottam, hogy a funkcióspecifikus kód és az azt működtető celluláris rendszer maguktól nem jöhettek létre. Semmilyen környezeti hatásra, sejten belül vagy kívül (kivéve az intelligenciát). A neo-darwinizmus szerint a környezeti hatás egyébként is csak szelektál a véletlen mutáció által létrejött változatok között. A környezeti hatások átörökítésének tagadása (a neo-darwinizmus egyik legfontosabb elve) persze ma már tarthatatlan, ezért is gondolják nagyon nagy számban biológusok (az ID körein kívül is), hogy a neo-darwinizmus (Modern Szintézis) mint elmélet halott. Az új elméletek, amelyek a sejtet vagy a testet teszik meg alapegységként a gén helyett, egyelőre nem tudják magyarázni, hogy a rendszer hogyan jött létre. A rendszer van. Hogy hogy jött létre, arra megfelelő mechanizmusok nélkül nincs ma válasz. A probléma szerintem sokkal nagyobb ma, mint mikor még csak azt gondoltuk, hogy a gének irányítanak mindent.

    Megnéztem a linkeket, amiket küldtél. Nem akarok kontárkodni a témában, de eddigi olvasmányaim alapján úgy tudom, hogy maga Joseph Thornton (a belinkelt cikkek egyik szerzője) hangsúlyozta egy 2009-es tanulmányában, hogy a fehérjék rendkívül érzékenyek a változásra, mert bármilyen módosulás könnyen funkcióvesztéssel jár. A különböző funkciót ellátó fehérjék közti különbségek nem egyetlen mutációt igényelnek, hanem általában sokkal többet. Ez azt jelenti, hogy az evolúciós folyamatban káros vagy semleges fázisokon is át kell mennie a fehérjének, és ilyenkor „helyettesítésre” van szükség (Thornton szava). Annak a kombinatorikai esélye azonban, hogy minden rendelkezésre álljon, Thornton szerint lényegében nulla. Az általad hivatkozott szerző beszél tehát a kombinatorikai problémáról az ősi formákba való visszaállítás kapcsán, ami nyilván igaz a feltételezett evolúcióra is.

    A dolog nem úgy áll tehát, hogy a fehérjék egyszerűen csak együtt fejlődtek a környezettel. A fehérjék ennél úgy tűnik, sokkal-sokkal érzékenyebb „jószágok”. És hát ami ennél még lényegesen nagyobb probléma: nem egy burjánzó rákos sejtről, hanem rendkívül szofisztikált celluláris rendszerekről beszélünk, amelyeket több szinten, hierarchikusan tárolt információ vezérel! Bill Gates szerint sokkal bonyolultabb rendszerek ezek a biológiai rendszerek, mint bármely szoftver, amit az ember létrehozott. Az ilyesmi nem fejlődik csak úgy együtt (környezeti hatásra vagy anélkül). Azt simán el tudom képzelni, hogy az olajmezők növények és állatok szerves maradványaiból keletkeztek évmilliók alatt. Ehhez nem kell értelem. Azt nem tudom józan ésszel elképzelni, hogy akár egyetlen élő szerv összerakta így magát. Mert a komplex, funkcionális rendszerek nem jönnek létre intelligencia nélkül. Ez az általános, egyöntetű tapasztalatunk. A véletlen mutáció bele tud piszkálni az információba, de funkcióspecifikus rendszereket nem tud felépíteni. És ezt bizony a matematika is vizsgálhatja a biológiai folyamatok megismerése után.

    Csodálkozom, hogy az RNS-világ hipotézist jó elméletnek tartod. Amikor ősszel Cambridge-ben jártam, bementem a Cambridge University Press boltjába, és az egyik könyv, amit hosszú ideig olvasgattam, Pier Luigi Luisi The Systems View of Life: A Unifying Vision c. könyve volt. Luisi, aki az élet eredetének kutatásában az egyik legismertebb szaktekintély ma, kifejezetten ellenségesen ír a könyvben az ID mozgalomról. Ezt azért említem meg, mert a következő mondat viszont meglepő lesz: maga Luisi mondja ki, hogy az RNS-világ hipotézis alaptalan fantázia. Mások is élesen támadják a hipotézist. Stephen Meyer az élet eredetével kapcsolatos kutatásokból írta doktori disszertációját a Cambridge-i Egyetemen. Signature in the Cell c. könyvében egy egész fejezetben veszi górcső alá a hipotézissel kapcsolatos áthidalhatatlannak tűnő problémákat. Engem Meyer részletes érvei abszolút meggyőztek arról, hogy az RNS-világ tarthatatlan elmélet, semmilyen szinten nem magyarázat az élet eredetére. Ha érdekel, össze tudom foglalni az érveit. (Ez a cikk néhány további kritikát is megemlít.) Amit eddig megértettem az elméletből, annak alapján nem tűnik jó elméletnek. Inkább science-fiction, mint valódi tudomány.

  • istván says:

    “Azt állítottam, hogy a funkcióspecifikus kód és az azt működtető celluláris rendszer maguktól nem jöhettek létre.”

    őszintén nem értem, hogy miért gondolod így, olvasom a szavakat az érveidben és úgy látszik valamit nagyon nem értek meg, kicsit fogyatékosnak is érzem magam.
    az megvan, hogy elsőre nem kell, hogy funkcióspecifikus legyen egy rendszer?
    egy sima fizikai hatás kihasználása is előnyt jelenthet, Pl.:kovalensen kapcsolt aminosavak jól raktározhatóak, nehezebben diffundálnak át a határoló membránon, megváltoztathatják a sejten belüli ozmotikus viszonyokat, stb…
    persze az is lehet, hogy egyáltalán nem értem, hogy mit jelent az, ha valami funkcióspecifikus.

    ne érts félre, ezek az elméletek szerintem is a sci-fi kategóriába tartoznak, de a sci-fi-k között is van olyan amiben több valós, vagy “akár lehetne is” elem található. az óriási szakadékot is látom az elméletek és a valóság között, még egy evolúció hívő is látja, de mivel az elmélet önmagában konzisztens és a valóságnak mégiscsak lennie kellett valahogy, Isten pedig nem létezik, ezért jobb híján elfogadja az elméletet.

    szerintem sem magyarázzák meg vagy bizonyítják be, hogy az élet így jött létre, hiszen ezt elméletek nem tudják megtenni, csak az elméletek kísérletes igazolása.
    ha azzal érvelnél, hogy mivel kísérletesen nem sikerül bizonyítani, hogy ilyen önszerveződő molekula-kupacok a legoptimálisabb körülmények között is létrejönnének maguktól, sőt a Földön sehol sem tudjuk megfigyelni, egyik feltételezett fázisát sem, ezért nincs okunk feltételezni, hogy van ilyen folyamat, az egy tartható állítás lenne. talán.

    szerintem annak, hogy funkcióról beszélünk is csak azért van létjogosultsága, mert önmagunkat nem pusztán anyagként határozzuk meg. Hívőként ez világos, de ha -tegyük fel- csak anyag létezne a világon, akkor ez nem funkció lenne, hanem anyagi folyamat, aminek a végterméke más szerkezetű anyag, ami megváltoztatja más anyagok szerkezetét. Amikor funkciót látsz benne, akkor már értelmezed a megfigyelt tényt.
    szerintem helyesen, az átlag materialista szerint nem.

    őszintén nem szeretem ezeket “hogyan lett az élet” vitákat, és csak azért szólok bele, mert folyamatosan azzal szembesülök, hogy a keresztények úgy érvelnek valami ellen, hogy nem értik azt. ez pedig nagyon ellenkező hatást ér el. akármilyen körültekintőek is, a te érveid sem hiszem, hogy meg tudnak győzni egy következetesen gondolkodó evolúció hívőt arról, hogy téved.

    kérlek magyarázd el nekem, hogy mi az hogy funkcióspecifikus információ, de ne egyszerűen, hanem úgy hogy egy ötéves gyerek is megértse.

    a cikkekkel nem akartam bizonyítani semmit, de jól megmutatják, hogy a fehérjék alaptermészete miatt, kis változások is lényegesen eltérő funkció megjelenéséhez vezethetnek.
    az meg azért nem a világ vége ha egy fehérje egy időre elveszíti a funkcióját, hiszen elég sok élőlény diploid vagy sokszoros kromoszóma készlettel rendelkezik, és a haploidokban is duplikálódhatnak szakaszok
    (igen, elméletileg, ritkán, szerintem sem bizonyít semmit, de ezek csak elméletek)

    elismert kutatók neveinek a felsorolása belőlem a kívánttal ellenkező hatást vált ki, a véleményemet a tények vagy jó érvek tudják megváltoztatni. szerintem ők is arról beszélnek, amiben hisznek, hiszen ezen a területen pont a tényeknek és a megfigyeléseknek vagyunk híján

    most elolvastam újra a válaszodat és úgy látom, hogy nem helyezkedtél bele teljesen az általam felvetett nézőpontba. olyan, mintha elkezdenél válaszolni arra, amit írtam “A dolog nem úgy áll tehát, hogy a fehérjék egyszerűen csak együtt fejlődtek a környezettel” aztán úgy folytatod, mintha nem is írtam volna semmit “rendkívül szofisztikált celluláris rendszerekről beszélünk, amelyeket több szinten, hierarchikusan tárolt információ vezérel!”
    értem, hogy most ilyen; érted, hogy egy evolúció hívő szerint tized ennyire sem kell bonyolultnak lennie ahhoz, hogy működjön?
    azt is értem, hogy annak, hogy pont ilyen legyen végtelenül kicsi az esélye, és ha csak egy komponens is másmilyen lenne, akkor nem működne, de ha egy komponens más lenne, akkor azzal arányos mértékben az összes többi is más lenne, és együtt ugyan olyan jól működnének.
    a valószínűség önmagában nem azt teszi hihetetlenné, hogy ilyen rendszerek létrejönnek, hanem azt, hogy pont ez a mostani valósult meg a végtelen lehetőségek skálájából.

    igyekszem lassan abba hagyni, mert ebben nagyon el fogunk fáradni, tök fölöslegesen

  • istván says:

    a másik kettőt is megnézted?

  • Szabados Ádám says:

    istván,

    akkor először címszavakban összefoglalom Meyer fő érveit az RNS-világ hipotézissel szemben, hogy ne csak nevekkel dobálózzak. Ezeket a problémákat mások is megfogalmazzák, akik az élet eredetének kutatásával foglalkoznak, tehát nem csak Meyer látja őket, de én most Meyer érveit foglalom össze:

    1) Az RNS építőegységeit nehéz szintetizálni, viszont könnyű lerombolni. Robert Shapiro és Stanley Miller külön-külön bebizonyították, hogy valódi prebiotikus környezetben gyakorlatilag lehetetlen, hogy ez a szintézis bekövetkezzen. (Ennek a bizonyítását Meyer részletesen ismerteti.)

    2) A ribozim fontos pontokon nem képes helyettesíteni a fehérjét. Ez súlyos problémát jelent a hipotézis számára.

    3) Az RNS-alapú fordító- és kódoló-rendszer hipotézise implauzibilis. (Meyer részletesen és meggyőzően bizonyítja a folyamat képtelenségét, miközben az elmúlt években született tanulmányokra is támaszkodik, amelyek ugyanerre a következtetésre jutottak.)

    4) Az RNS-világ hipotézis nem ad magyarázatot a genetikai információ eredetére. (Signature in the Cell c. könyvében Meyer ezzel kapcsolatban is hosszas, részletekbe menő, más tanulmányok által is igazolt bizonyítást ismertet.)

    5) A ribozim megtervezésével végzett kísérletek nem tudják szimulálni az irányítatlan kémiai evolúciót. Jack Szostak és David Bartel kísérletei az RNS-világ hipotézis igazolására például a természetes szelekciót szimulálják, mielőtt az általuk feltételezett prebiotikus környezetben az első önmagát másoló molekula létrejött volna. A replikátorok a kísérletben maga Szostak és Bartel!

    Hogy mi a funkcionálisan specifikus információ, és mi a különbség a sima komplexitás és a funkcióspecifikus komplexitás között, azt itt magyaráztam el egyszerűen: Mi a „komplex, funkcionálisan specifikus információ”? Ha ennél még egyszerűbben akarom elmagyarázni, akkor a következőt mondanám. Amikor régészek egy kőtáblát találnak, és azon karcolások vannak, az sima komplexitás. Ilyet a természet könnyedén létrehoz. Amikor a kőtáblán olyan karcolásokat találnak, amelyek jelentenek is valamit (pl. akkád nyelven írt felirat), vagyis amikor a komplexitás szemantikai funkciót tölt be, az a funkcionálisan specifikus komplexitás. Ilyenkor a karcolatok (rovátkák) megfelelnek valamilyen tőlük független mintának. Ilyet a természet nem hoz létre, hanem csak intelligencia. Ezért van az, hogy az intelligens okokat képesek vagyunk kutatni (pl. régészet, kriminalisztika, SETI). Ha a régész funkcionálisan specifikus komplexitással találkozik, azonnal tudja, hogy kultúra nyomaira bukkant.

    És hogy az óvodás is értse, hadd mondjak két még ennél is egyszerűbb példát. Ha a földön találsz egy kavicsot, nem lepődsz meg. Ha a földön találsz egy kavicsot, amire egy mackó van rajzolva, azon kezdesz gondolkodni, hogy vajon ki rajzolta a mackót a kavicsra. Ez a funkcióspecifikus komplexitás. Amikor apa nyomogatja a kapu melletti táblán a számokat, akkor kinyílik az ajtó. Ez megint funkcióspecifikus komplexitás, hiszen apa tudja, hogy melyik számokat kell megnyomni ahhoz, hogy a kapu kinyíljon. Nem csak az nyitja ki a kaput, ha egy csomó számot megnyomunk, hanem az, ha pont a jó számokat nyomjuk meg, a jó sorrendben. Amikor te nyomkodod a számokat, akkor azért nem nyílik ki a kapu, mert nem valószínű, hogy csak úgy véletlenül a jó számokat a jó sorrendben nyomod meg. Ez a funkcióspecifikusság nélküli komplexitás.

    A komplexitás is információ, shannoni értelemben. A gyerek által nyomogatott számok sora is komplex információ. A lehetőségeket szűkíti le azokra a számokra, amelyeket megnyomott. Kicsi az esélye annak, hogy pont azok a számok pont abban a sorrendben legyenek, ahogyan megnyomta őket. A valószínűség azonban hatványozottan csökken, ha ennek a számsornak valamilyen tőle független mintához kell igazodnia. Például meg kell feleljen a kapuba programozott számsornak, hogy kinyíljon a kapu. Ez az, amire nagyon kicsi komplexitás felett csak intelligencia képes, irányítatlan anyagi folyamatok nem. Ezért működnek a PIN-kódok. És ezért van az, hogy funkcionálisan specifikus információ esetében ösztönösen is tudjuk, hogy intelligens ok áll a háttérben.

    A DNS kódja és a sejtben több szinten tárolt információ funkcionálisan specifikus információ. A nukleotidok sorrendje és a kodonok határozzák meg, hogy milyen aminosavakból milyen fehérjék fognak megépülni a test különböző életfunkcióinak ellátására. Epigenetikai szinteken válik hierarchikusan tárolttá, hatványozottan komplexebbé ez az információ és a működést vezérlő információ funkcionális specifikussága. Komplexitás kialakulhat irányítatlan folyamatok révén is, lásd kristályok. Nagy mennyiségű funkcióspecifikus komplexitás viszont csak intelligens okok hatására alakul ki. A SETI egész projektje erre épül. És a hétköznapi tapasztalataink is. (Vö. Intelligens okok az univerzumban? és Maláj repülőgép eltűnése: intelligens ok?)

    Nem beszéltünk eddig a termodinamika második törvényéről. Talán azért nem, mert tudjuk, hogy a földi élet nem zárt rendszerben létezik, ezért ez a törvény nem zárja ki annak a lehetőségét, hogy külső hatásra valamiféle rendezettség jöjjön létre (mint amilyenek a kristályok). Én sem szoktam használni ezt az érvet, pont emiatt. Ez azonban többnyire inkább csak elvi lehetőség. Ettől még hétköznapi tapasztalatunk, hogy a termodinamika második törvénye rendkívüli erővel hat a rendezettség ellen. Ha ez nem is zárja ki teljes mértékben rendezett dolgok véletlenszerű létrejöttét, ezt is számításba kell vennünk, amikor valaki arról beszél nekünk, hogy a Földön magától, irányítatlan folyamatok révén elképesztően bonyolult rendszerek épültek meg (mint amilyen a sejt). A funkcióspecifikus információ által vezérelt rendszerek ráadásul teljesen másfajta rendezettséget jelentenek, mint a sima komplexitást mutató kristályok. Olyan rendezettséget jelentenek, amilyent minden tapasztalatunk intelligens okhoz köt. Ezért buknak meg rendre az önszerveződés elméletei az élet eredetének magyarázataként.

    És végül egy kísérlet, amire nem egy tudós (pl. J. Tour, J. Wells) tett már javaslatot. Ha az élet magától össze tudott állni néhány aminosavból az ősi prebiotikus környezetben, akkor biztosan meg tud ez újra történni, ha a feltételezettnél jóval optimálisabb környezetet hozunk létre, amelyben jelen van kis helyen az összes szükséges összetevő. Fogjunk például egy élő sejtet, tegyük bele egy steril kémcsőbe, teremtsük meg a kémcsőben a sejt számára legoptimálisabb környezetet (savasság, hőmérséklet stb.), majd egy steril tűvel szúrjuk ki a sejt membránját, hogy az alkotóelemei szabadon távozhassanak a kémcsőbe. Majd várjuk meg, hogy összeáll-e újra sejtté. Ha az élet valóban olyan könnyen magától létrejött, minden odds ellenére is, vajon mi akadálya annak, hogy sokkal-sokkal optimálisabb környezetben ez újra megtörténjen? És vajon miért van az, hogy tudjuk, ez a kémcsőben nem fog menni?

    Bocsánat, ha kicsit terjengős volt a válaszom.

  • Lima Rui says:

    Idő hiányában most dzsaszpernek (-nak?) és Vesztnek külön nem válaszolok, bár talán találnak pár pontot, ami őket is érinti. dzsaszpernek azért röviden: „Az expresszióvezérléshez először is egy olyan kontextus kell, ami a DNS egy szeletkéjét aktiválni, deaktiválni tudja, pl. transzkripciós faktorokra. Meg kell egy szervezet, aki a transzkripciós faktorokon keresztül vezérelni tudja a fehérjeszintézist. Hiába alakulnak ki nukleotidláncok, transzkripciós faktorok, miegymás nélkül nem lesz expresszióvezérlés. Mindezt már nagy valószinűséggel egy valamire való prokariótának is tudnia kel „ Az élet keletkezéséről van szó, prokarióták még távolról sincsenek a képben. Ahogy TF-ekre sincs szükség, így TFBK-re sem.
    Éva: Az offért valóban én tehetek, bocsánat. „“A jövő farmja” c. filmben is azt mondja egy kertész, hogy amennyit dolgozik, az max 2 óra hetente, és az is főképp betakarítás.” Ahogy Veszt is utalt rá: az emberiség 10 ezer éve ismeri a mezőgazdaságot, emberek milliárdjai robotolták végig az életüket a földeken, gyakran a semmiért, erre ez a kertész 2 óra alatt letudja az egészet? Rossz vicc.
    istván: Érdekesek a cikkek. A világképemet erősítiknem is világos, melyik ponton kérdőjeleznék meg, bár talán nem is ez volt a célod. Jó lenne – a vita szempontjából is – ha dínó DNS-t lehetne szekvenálni, de ez a kevés molekuláris bizonyíték is az evolúciót erősíti. „Under scanning electron microscopy (SEM), features seen on the external surface of dinosaurian vessels are virtually indistinguishable from those seen in similarly prepared extant ostrich vessels, suggesting a common origin.” (A baraminológia mit kezd a T-rexszel? Nem hiszem, hogy egy nembe teszi a struccokkal.) Szimpatikus a hozzáállásod a témához, de az ajánlásodat János evangéliumával kapcsolatban sajnos nem tudom megfogadni. Ha esetleg megjelölöd a fejezet(ek)et, ami(k)re gondolsz: http://szentiras.hu/SZIT/Jn
    Ádám: Third Way: „ Neo-Darwinism ignores important rapid evolutionary processes such as symbiogenesis, horizontal DNA transfer, action of mobile DNA and epigenetic modifications. „Ha vannak ilyen neo-darwinista „tudósok”, akkor azok hülyék. Ezek létező, jól dokumentált események, melyeket nemhogy hiba kihagyni az evolúciós elméletből, hanem egyben hatalmas ostobaság is, hisz ezek mind erősítik azt, hisz jelentősen felgyorsítják. Csak példaként: szimbiogenezis, azaz kloroplasztiszok nélkül nehéz lenne elképzelni a világot olyannak, amilyen, még mindig kemolitotrófok szüttyögnének a mélytengeri füstölgőkben. Ez a Third Way ugyanaz az a Second Way: a darwinizmus, az evolúció, csak beilleszti magába a legújabb tudományos eredményeket, ahogy kell. Lehet vitatkozni, hogy melyik erő a fontosabb, melyiknek volt nagyobb a jelentősége, de sok értelme nincs (bár egy pontmutáció nehezen versenyezhet egy kloroplasztisz szimbiogenezissel.) Úgy gondolom az Ádám által idézett kételkedők is ezeket az eredményeket, elméleteket hiányolhatták, amikor nem találták elegendőnek egy-egy véletlenszerű mutáció megjelenését annak megmagyarázásához, hogy alakultak ki ilyen gyorsan a fajok, hogy lehettek ilyen változatosak. De ezek mind több évtizedek ismeretek, nem kéne újdonságként hatniuk. Szerintem a Third Way, ahogy a neve is mutatja, egy harmadik oldalként pozícionálja magát, nyíltan elhatárolódik a „hagyományos” (neo)-darwinizmustól, melyet az USA egyes részein úgy kezelnek, mintha az ördögtől való lenne, így próbálják elkerülni a rögzült idegenkedést és gyanakvást és átadni a tudásukat. Nem mondanak ellent az evolúció „hagyományos” ideáinak, csak eltolják a hangsúlyt ( „The DNA record does not support the assertion that small random mutations are the main source of new and useful variations.”), viszont az ez irányban nem képzett olvasóközönség számára egyszerűen próbálnak üzenni, könnyebb magukat elhatárolni. Szerintem. Bár szerintem nem jó a módszerük, erre Ádám, te vagy a példa., hisz az evolúciós-elmélet szakértőinek megosztottságát véled látni, ami tévedés.
    „Ez majdnem olyan nevetséges, mint a Wistar konferencia.
    ???” Lehet, hogy nem maga a Wistar konferencia nevetséges, de az a része mindenképpen, amiről beszéltél. Ahogy írtam korábban: „Szóval 4000 db 150 aa hosszú fehérje közül statisztikailag 1-ben valahol kialakul a kálcium-kötés képessége. Legalább 110 ezer domént ismerünk, bár ezek közül sok ugyanaz, csak más néven.” 150*4000=600ezer, azaz 6*10^5 aminosav. 1 mol aminosav az 6*10^23 db aminosav, ami átlagosan 140 gramm. A különbség az 10^18, tehát 1 attogramm aminosav ha 150 aminosav-hosszú fehérjékbe rendeződik, akkor 1 molekula valószínűleg kialakítja a kálcium-kötés képességét. A kálcium egy rendkívül fontos másodlagos hírvivő molekula, rengeteg folyamatban szerepe van, mondhatnám, hogy sok konzervált funkciója van (erre még visszatérek).
    „Azért alakulnak ki a fehérjék, mert ott van a kód. Az információ, amely az aminosavak sorrendjét és a fehérjék összeszerelését meghatározza. Akkor merül fel a döbbenetesen kicsi (10^195) probabilitás, ha a kód véletlen kialakulását feltételezzük. „Fehérjék kialakulásához nem kell feltétlenül kód, az aminosavak összekapcsolódásából is létrejöhet, melyek spontán létre tudnak jönni formaldehidből, cianidból. Ha egy kialakult fehérje, vagy inkább peptid, preferál nukleotidokat, akkor az egyben kialakítja a kódot is.
    „Mi van, ha a nukleotidokhoz eleve kapcsolva van az aminosav? Eleve?„ Tehát egy nukleotid-aminosav komplexről van szó, melyben az egyik lánc kialakulása megalkotja a másik láncot is. Ha a kialakuló peptid funkciót lát el, pl kálciumot köt és ez hasznos az adott környezetben, akkor az így kialakult nukleinsav lánc is rögzül és fennmarad. A funkció és az eredete nem választható el egymástól.
    „Egységnyi génről egységi idő alatt egységnyi fehérje készül. Nem túl bonyolult rendszer. ???„ Egy primitívv, ősi transzkripciós rendszerről beszélek, ahol a transzkripciót nem a promóter vagy TF-ek határozzák meg, hanem hogy hány kópia van a génből. Ha X génből az adott rendszerben 10 van, akkor percenként 10 RNS és 10 fehérje készül el, míg az Y génről, melyből 5 kópia van, arról percenként csak 5 fehérje készül, így alakul ki egy expressziós mintázat. Ha az elősegíti a túlélést, akkor előnyös. Ha az Y-ról is 10 kópia készül, akkor az eltolja a protosejtben lévő reakciókat és elpusztul. Hasonlóan, ha Y kétszer hosszabb X génnél, akkor 2-szer lassabban készülnek el róla a fehérjék, lassabban aktiválódik a gén. Ez egy olyan primitív génexpressziós rendszer, melynek még a vírusok is fejlettebb változatát használják, de mint minden mögött, mögöttük is 4 milliárd év evolúció áll (így vagy úgy, ez nehéz kérdés a vírusoknál persze).
    „Az expresszivezérléshez nem kell Tervező, csupán nukleotidláncok spontán kialakulására van szükség, ami viszont lehetséges.???„ Itt pongyolán fogalmaztam. A primitív transzkripcióra gondoltam, illetve az RNS-nukleotidokhoz kötött aminosavak már egyben transzlációt is jelentenek. Persze a ribozimeknél nincs transzláció, ott az RNS-nek van enzimatikus és kódoló funkciója, és ehhez hasonlóak a mikroRNS-ek is. A nukleotidláncok kialakulására később lesz egy linkem.
    Ki ez a Meyer? A HarperOne-os publikáció nem mérvadóak. És úgy tűnik, más nincs neki.
    1) Valódi prebiotikus környezet? Lehetett belőle több ezer féle. Elég nagy ez a bolygó és sok idő 800 millió év. A korábbi linkeden volt ez a bekezdés, ebből is az utolsó mondat az érdekes: „David Deamer tells her (p. 43) that the RNA and DNA monomers don’t link up naturally: “the laws of thermodynamics do not allow them to polymerize because there is a tremendous energy barrier to getting them to form bonds.” That’s especially true in water, he says, which breaks down (hydrolyzes) RNA.”Az izolált RNS-t vízben oldjuk fel (A vízben lévő DEPC az esetleges RN-ázoktól véd, nem a víztől). Valamint: „When the RNA is double-stranded or involved in nucleotide base pairing, it is more stable and spontaneous cleavage is significantly less likely.” https://en.wikipedia.org/wiki/RNA_hydrolysis . Újabb cikkeket is kéne olvasni, sőt, olyan cikkeket, melyek ezzel a kérdéssel foglalkoznak kísérletesen: „Here, we show that glycosylation of melamine and BA by ribose-5-phosphate (R5P) occurs spontaneously in water to produce nucleotides in yields of up to 55% and 82%, respectively. When combined, the nucleotides form supramolecular assemblies with Watson–Crick-like base pairs, even within the crude reaction mixtures. These assemblies are shown to preferentially incorporate and increase the fraction of the b-anomer of the melamine nucleotide over the a-anomer. These findings demonstrate prebiotically plausible mechanisms for the selection of nucleotides in both nucleobase and sugar structure.” http://www.nature.com/articles/ncomms11328
    2) 2) A ribozim milyen fontos ponton nem tudja helyettesíteni a fehérjét? Ehhez eleve tisztázni kéne, hogy a protosejt számára enimetikaus reakciók szükségesek ahhoz, hogy éljen. Ezeket mi tudja biztosítani? Ezek akár létezhettek az első protosejtek előtt is és akár replikálódhattak is, akár fehérje, akár ribozim, akár más molekula.
    3) Az RNS világban nem feltétlenül van szükség fordításra, az később is kialakulhatott, hisz az RNS ribozim már önmagában is végrehajt reakciókat. RNS vírusok léteznek, RNS-ben kódolnak. A mRNS is a DNS komplementer szála. Mi implauzibilis ebben?
    4) Az RNS-világ hipotézis önmaga egy magyarázat a genetikai információ eredetére (is).
    5) Az a gond, hogy a kutatók számára nem áll rendelkezésre 800 millió év és egy bolygó méretű kémcső, hogy megvárják a szükséges molekulák, sőt az élet létrejöttét.
    „Fogjunk például egy élő sejtet, tegyük bele egy steril kémcsőbe, teremtsük meg a kémcsőben a sejt számára legoptimálisabb környezetet (savasság, hőmérséklet stb.), majd egy steril tűvel szúrjuk ki a sejt membránját, hogy az alkotóelemei szabadon távozhassanak a kémcsőbe. Majd várjuk meg, hogy összeáll-e újra sejtté. „ Ez a kísérlet olyan naiv, hogy rá sem keresve J. Tour-ra, J. Wells-re, megkockáztatom, hogy legalább 50 éve hajtották végre. A legegyszerűbb sejt mögött is közel 4 milliárd év evolúció áll. A legegyszerűbb mai, ismert életformák 475-540 gént tartalmaznak: https://en.wikipedia.org/wiki/Nanoarchaeum_equitans . Az első élőlénynek tekinthető replikon ennél mérhetetlenül egyszerűbb lehetett, nem is feltétlenül hordozta minden funkcióját gén (vagy gén-analóg) formájában, mint pl a vírusok. Ha pl egy spontán létrejövő ribozim vagy fehérje vagy maga a membrán az adott környezetben nagy számban jelen volt és hasznos funkciót láthatott el a protoélőlény számára, akkor azt nem kellett kódolnia, csupán minden új egyednek magába építenie.
    „Nagy mennyiségű funkcióspecifikus komplexitás viszont csak intelligens okok hatására alakul ki.” Úgy érzem a saját világképeden belül nem állja meg a helyét ez az axióma, hisz Isten maga is funkcióspecifikus komplexitás, nem igaz? Tehát intelligens ok hatására alakult volna ki? Ha Isten mindig is létezett, akkor ezek szerint Ő nem funkcióspecifikusan komplex, csak egy véletlenszerű információhalmaz.
    A földi élet egyedülálló (még akkor is, ha van máshol is élet, ahogyan az az élet is egyedülálló), így persze, hogy nincs mihez hasonlítani. Attól még, hogy ember által teremtett dologhoz hasonlítod, nem jelenti azt, hogy intelligencia hozta volna létre. Ilyen erővel, ahogy a PIN kódot és az operációs rendszert is ember hozta létre, vagy bármit amihez hasonlítod, úgy eszerint ugyanúgy az életet is hozhatta az ember létre. Paradoxon? A te logikád szerint akár azt is felhozhatnád példának, hogy az életet Isten teremtette, hisz angyalokat is Ő teremtette. Sőt, minden molekulát ő teremtett. Ha ismernénk más, az élethez hasonlóan bonyolult, de spontán létrejövő rendszert, akkor vita se lenne és az élet se lenne ilyen egyedülálló. Ez önmagában nem érv. Korábban beszéltem a kálciumról, melynek rengeteg funkciója van, pl kálcium-kötő fehérjéket aktiváló vagy dekatváló jel, metalloenzim katalitikus centruma vagy a csontokban. Szó sincs génről, fehérjéről, ez csak ez kémiai elem, melynek funkciója van. Persze önmagábam ezek nagy részét nem hajtja végre, enzimek irányítják, kötik meg. Manapság. De nem 4 milliárd éve. 2 up kvark és 1 down kvark proton kódol, míg 1 up és 2 down neutront. Ezek együtt egy neutronnal deutériumot. Bármilyen kvark sorral leírhatsz bármilyen elemet, mellyel molekulákat alkothatsz. 2*10^33 gramm a Nap tömege, melynek nagy része hidrogén. A Nap rengeteg funkciót ellát, többek között biztosítja a Földön az életet, de pályán tart 8 bolygót és milliónyi égitestet, szuperüvegházhatást okoz a Vénuszon, csillagfelhők közelében elhaladva gerjeszti a gázt, ezzel újabb csillagok és naprendszerek, bolygók létrejöttét segíti elő. Mind tekinthető funkciónak. Intelligencia tervezte? Persze, szerintetek mindent Ő tervezett, bár a vita mégsem erről szól. A Nap nem egyedülálló, de a földi élet igen, legalábbis nem ismerünk ehhez foghatót, így ebből adódóan a funkciója is sokkal bonyolultabb. Mondhatnám akár, hogy per definitum.

  • Szabados Ádám says:

    Lima Rui,

    kicsit félek attól, hogy megint beleragadunk abba a körbe, amiből egy ideje próbálok kilépni, de elmondom, mit gondolok az általad leírtakról. (Egyikünk sem bírja abbahagyni.):)

    1. Denis Noble (a Third Way egyik vezető biológusa) alapvetően új evolúciós paradigma megalkotásának szükségességéről beszél (ezek az ő szavai), mert nem arról van csupán szó, hogy a régit új ismeretek egészítik ki, hanem arról, hogy a régi mechanizmus (a tankönyvekben ma is ismertetett Modern Szintézis, amelyben a véletlen mutáció által előidézett variáció és a természetes szelekció, kiegészülve a genetikai sodródás jelenségével, a feltételezett evolúció motorja) az új ismeretek fényében nem működik. Rendszerszinten funkcionálnak az élő szervezetek, ezért a magyarázatoknak is rendszerszintűeknek kell lenniük. Egyelőre csak a közös leszármazásban való hit maradt meg, olyan mechanizmus nincs, amely magyarázná a rendszerek kialakulását. Az, hogy azt mondjuk, együtt fejlődtek ki, még nem magyarázat, hanem előfeltevés.

    2. Egy csomó állításod (pl. „Ha egy kialakult fehérje, vagy inkább peptid, preferál nukleotidokat, akkor az egyben kialakítja a kódot is.”) olyan hatással van rám, mintha mondjuk arról vitáznánk, hogy Michael Phelps át tudja-e úszni az Atlanti-óceánt, és te rendre az olimpiai aranyaival és világrekordjaival jönnél, amelyeket medencében úszott. Valamiért nem érted a funkcióspecifikus információ által felvetett problémát, vagy ha érted, nem veszed komolyan. Amikor arról beszélsz, hogy a peptid preferál nukleotidokat, tehát ott a kód, akkor például nagyvonalúan elmész amellett, hogy egy élő sejt esetében milyen mennyiségű és funkcióspecifikus komplexitású információról beszélünk! Meg amellett is elmész, hogy mindez az információ rendszerszinten van tárolva a sejtben, sőt, az egész szervezetben. Komolyan vakarom a fejem, hogy miért gondolod valódi magyarázatnak, amit leírsz.

    3. Az RNS-világ hipotézissel kapcsolatos érveidre:

    a) Amit a prebiotikus környezetről írsz, az kicsit a nesze semmi, fogd meg jól kategória. Ha nem tudjuk, milyen volt, miről beszélünk egyáltalán? A 800 millió év a probabilisztikus határok szempontjából nem hosszú idő, főleg, ha ez talán inkább csak 2-300 millió év, ahogy a legújabb élő szervezet felfedezése kapcsán felvetődött (akár 4,22 milliárd éves is lehet a lelet).

    b) Az, hogy a ribozim egy-két ponton helyettesíteni tudja a fehérjét, kb. olyan, mintha azt mondanád, hogy a papírlappal is el tudja vágni az ember az ujját, ergo nincs szükség késekre. Abból, hogy egy vagy két funkciót át tud venni a ribozim, még nem következik, hogy a többi ezer és ezer funkció ellátásában is helyettesíteni tudja a fehérjéket. Itt megint erős fantázia egészíti ki azt a hatalmas szakadékot, ami a valóságot és az RNS-világ hipotézist egymástól elválasztja.

    c) Az RNS-alapú transzlációs és kódoló rendszerrel kapcsolatos érvben az a feltételezés implauzibilis, hogy ebből fejlődött ki az első önmagát reprodukáló sejt, amelyben számos speciális fehérje biztosítja a genetikai információ feldolgozását és szabályozza a metabolikus folyamatokat. Óriási a szakadék.

    d) Az RNS-világ hipotézis egyáltalán nem ad magyarázatot arra, hogy hogyan jött létre a nukleotidok sorrendjében tárolt információs kód. Éppen az a probléma, hogy az ilyen jellegű funkcióspecifikus információ véletlen kialakulásának propabilitása a nullához konvergál, az önszerveződés pedig az információ kód jellege miatt lenne önellentmondás (erről fent már sokszor írtam).

    e) Nem kellene 800 millió év a kémcsőben, és nem csak azért nem, mert az élet talán sokkal előbb megjelent már a Földön, hanem azért sem, mert itt minden egy helyen van, semminek nem kell kialakulnia hozzá. Ott vannak a fehérjék (nem csak aminosavak, amelyeknek elképesztő szerencsével a megfelelő kombinációba kellene rendeződniük), ráadásul pont a megfelelő fehérjék vannak a kémcsőben, ott van az egész genetikai kód is, az összes kémiai láncolat, a környezet pedig optimális. Mégsem fog összeállni a sejt. Tudjuk, hogy nem fog összeállni, mert itt világosan tetten érhető az a tapasztalatunk, hogy ilyen rendszerek nem jönnek létre maguktól. Akármennyit várnánk is rá. A folyamat inkább a további rendezetlenség irányába fog elmozdulni.

    4. Istent te hoztad megint a képbe. Én ugyan hiszem, hogy Isten alkotta a világot és benne az életet, tőle van az információ, amely egyben tartja és működteti az élet rendszereit, de a hozzászólásomban pusztán intelligens okról beszéltem. Szerintem az empirikus tudomány ennyit tud megállapítani, ezt viszont meg tudja állapítani. A jelenségek magyarázata intelligens ok után kiált. Amit Isten keletkezéséről mondasz, az Dawkins kicsit bugyuta érvének felmelegítése. Ezt inkább ne használd, Dawkins csapnivaló filozófus. Kategóriáhibát vét.

  • Gergely Erzsébet says:

    “………………………….. (Egyikünk sem bírja abbahagyni.):)
    …………………………………………………………”

    Számomra ez nagyszerű!
    Nem könnyen “emészthető” információk, melyeket mégis szívesen olvasok.

  • istván says:

    Kedves Ádám!

    “Amikor a kőtáblán olyan karcolásokat találnak, amelyek jelentenek is valamit (pl. akkád nyelven írt felirat), vagyis amikor a komplexitás szemantikai funkciót tölt be, az a funkcionálisan specifikus komplexitás. Ilyenkor a karcolatok (rovátkák) megfelelnek valamilyen tőlük független mintának. Ilyet a természet nem hoz létre, hanem csak intelligencia. Ezért van az, hogy az intelligens okokat képesek vagyunk kutatni (pl. régészet, kriminalisztika, SETI). Ha a régész funkcionálisan specifikus komplexitással találkozik, azonnal tudja, hogy kultúra nyomaira bukkant.”

    Értem. Tegyük fel, hogy materialista vagyok. Győzz meg, hogy miért kell funkciót látnom egy rakás molekula egymással való reakciójában. (Ne filozófiai szempontból)

    Az RNS világgal kapcsolatban elbeszélünk egymás mellett, mert mást értünk elmélet alatt. Számomra egy elmélet inkább csak gondolatkísérlet a te szavaiddal; semmire sem kötelez, semmit sem bizonyít. Egyszerűen csak egy érdekes “mi lenne ha”.
    Segítene a közeledésben, ha nem a funkció, hanem a kémia felől néznéd a dolgot, és nem a termodinamikára vagy a kísérletes igazolásra koncentrálnál, hanem a mechanizmusra magára, és annak is a logikájára.(ennél valóban nem több az RNS világ)

    A sejt kiszúrós és a hasonló példákat szerintem felejtsd el, mert senki sem állítja, hogy ezek a mai sejtekben található molekulák kezdtek önszerveződni. Világos, hogy ezek csak a már meglévő rendszerben funkcionálisak.

    ha érvelni akarunk az evolúció elmélete ellen, akkor vagy belülről kell tennünk, abból a világképből kiindulva, ami szülte, vagy először le kell fektetnünk az alapokat, hogy miért téves az a világkép és miért jó a mi világképünk. különben a végtelenségig el fogunk beszélni egymás mellett Lima Ruival.

    Kedves Lima Rui!

    Nem erősítik az evolúció elméletét, mert az, hogy két dolog nagyon hasonlít nem bizonyítja, hogy a két dolog egymásból fejlődött ki. Logikailag nem következik egyik a másikból.
    Mi is látjuk, hogy egy T-rex jobban hasonlít egy csirkére, mint egy kutyára vagy egy ostorosmoszatra, de ahogy írtam, ez tényszerűen nem bizonyít semmit. Ha empirikus alapról érvelsz akkor tedd azt, de ne váltogasd a tudományos hozzáállást és a hitet aszerint, hogy éppen melyikkel jársz jobban.
    Ha mégis felhasználod az érvelésben a saját hitvilágodat, akkor ismerd meg a vitapartnerét is és legyen súlya az ő hiten alapuló érveinek is.

    Bíztam benne, hogy objektíven és nyitottan állsz a dologhoz és nem csak azt hallod ki belőle, ami egybevág a már meglévő tudásoddal. Persze tudjuk, hogy a legjobb könyvek azok, amelyek azt mondják el az embernek, amit már tud, de így nehézkes lesz új nézőpontokat megismerni.
    érdekelt volna, hogy mi a véleményed arról (nem a tudományé, hanem az emberé), hogy egy 65 millió évnél idősebb kövületben eredeti tulajdonságokkal és szervezettséggel rendelkező sejteket és sejtalkotó molekulákat lehet találni. a válaszod alapján sejtem, hogy mi.

    János evangéliumával kapcsolatban félreérted az ajánlásom célját. Nem egy adatot kértem tőled, hanem személyes tapasztalatot, belehelyezkedést a másik nézőpontjába, a másik világába. Intellektuális erőfeszítést, alaposságot, nyitottságot.
    Belátom, hogy a te szempontodból ez csak felületesen kapcsolódik az itt folytatott vitához; a mi szempontunkból szerintem elválaszthatatlan tőle.
    21 oldal összesen a linkelt helyen, ennél a kommentjeid is majdnem hosszabbak. (mondjuk én a (papír)könyv formátumot preferálom)
    Szívből kívánom, hogy megértsd mi vesz rá valakit, hogy a szerinted evidens dolgokkal is szembehelyezkedve egy értelmetlen hülyeségnek rendelje alá az életét.

  • Szabados Ádám says:

    istván,

    Tegyük fel, hogy materialista vagyok. Győzz meg, hogy miért kell funkciót látnom egy rakás molekula egymással való reakciójában.

    Nagyon egyszerű. A nukleotidok sorrendje dönti el, hogy milyen aminosavak milyen sorrendben épülnek fehérjékké. A nukleotidok sorrendje tehát funkcióspecifikus információ. És ez csak a kezdet. A DNS nem fejérjekódoló szegmenseiben további információ van tárolva, amely többek között az átírást indítja és leállítja. Ezen kívül a sejtben epigenetikai szinteken is információ vezérli a működést. Szerintem nincs olyan materialista, aki tagadná, hogy a rakás molekula funkciót lát el.

    Az RNS világgal kapcsolatban elbeszélünk egymás mellett, mert mást értünk elmélet alatt. Számomra egy elmélet inkább csak gondolatkísérlet a te szavaiddal; semmire sem kötelez, semmit sem bizonyít. Egyszerűen csak egy érdekes “mi lenne ha”.

    Jó, de az elméleteket, gondolatkísérleteket mérlegre tesszük, hogy plauzibilisek-e. Széles Gábornak is volt elmélete arról, hogy a gravitáció kikapcsolható. A középkorban rengeteg elméletet gyártottak azzal kapcsolatban, hogy fémekből hogyan lehet aranyat vagy ezüstöt csinálni. Elméletnek érdekes az RNS-világ hipotézis, magyarázatnak pocsék.

    Segítene a közeledésben, ha nem a funkció, hanem a kémia felől néznéd a dolgot, és nem a termodinamikára vagy a kísérletes igazolásra koncentrálnál, hanem a mechanizmusra magára, és annak is a logikájára.(ennél valóban nem több az RNS világ)

    Ezt a javaslatodat nem igazán értem. A DNS legcsodálatosabb tulajdonsága az, hogy kódot hordoz, amely életfontosságú funkciókat határoz meg. Ennek a létrejöttét kellene megmagyarázni. Akár kémiailag is. Csakhogy az RNS-világ pont ezt nem teszi. A kiváló tudományfilozófus Polányi Mihály évtizedekkel ezelőtt elmondta, hogy ez elvi okokból miért nem is sikerülhet. Wigner Jenő is hangsúlyozta, hogy a kémiai evolúció lehetetlen. Elvi okokból. Olyan jellegű elvi problémák vannak, mint a perpetuum mobile esetében. Utóbbival kapcsolatos kísérleteket már nem is végeznek.

    A sejt kiszúrós és a hasonló példákat szerintem felejtsd el, mert senki sem állítja, hogy ezek a mai sejtekben található molekulák kezdtek önszerveződni. Világos, hogy ezek csak a már meglévő rendszerben funkcionálisak.

    Én nem is azt állítottam, hogy bárki szerint a mai sejtekben lévő molekulák kezdtek önszerveződni. Ennél sokkal-sokkal nehezebb utat vizionálnak azok, akik a kémiai evolúció plauzibilitásában hisznek. A hipotetikus kísérlet arra mutatna rá, hogy egy sokkal-sokkal optimálisabb helyzetben sem azt fogjuk tapasztalni, hogy a folyamat a rendezettség felé indul el, hanem éppen fordítva: egyre rendezetlenebb lesz. Pedig minden rendelkezésre állna.

    ha érvelni akarunk az evolúció elmélete ellen, akkor vagy belülről kell tennünk, abból a világképből kiindulva, ami szülte, vagy először le kell fektetnünk az alapokat, hogy miért téves az a világkép és miért jó a mi világképünk. különben a végtelenségig el fogunk beszélni egymás mellett Lima Ruival.

    Igen, ebben egyetértek veled. Metafizikai szűrők dolgoznak a háttérben. Aki materialista világnézettel közeledik a jelenségekhez, az soha nem fogja nyitva hagyni azt a lehetőséget, hogy a természet mögött természetfeletti okot vegyen figyelembe.

  • dzsaszper says:

    Lima Rui,

    ha nem annak az életnek a keletkezéséről van szó, amiből kifejlődtek a prokarióták, akkor meggyőztél 🙂
    Ha közös leszármazással együtt arról az életről, amiből a prokarióták, sőt a gerincesek is lettek, akkor nem tartom elégségesnek a válaszodat.

  • dzsaszper says:

    Ugyanez a válaszom arra is, hogy az RNS-világ hipotézis mit magyaráz és mit nem. Valami agyonegyszerűsített vírusféleséget, ami élt, ki tudja hogy, aztán nem volt túl stabil és eltűnt, azt esetleg gyengén és közelítően magyarázhat az RNS-világ hipotézis.

    Hol vagyunk még a szabályozott anyagcserétől meg a sejtszintű reprodukciótól?

  • istván says:

    inkább ne

  • Lima Rui says:

    1) Kedves istván: nem állítottam, hogy ez önmagában bizonyíték lenne az evolúció mellett. Számtalan bizonyíték szól a madarak és a dínók rokonsága mellett, sőt, hogy az előbbiek az utóbbiak leszármazottai. A cikkben leírt hasonlóság illik a felállított elméletbe, így erősíti azt. Nem ezen cikk alapján kötötték össze a két rendszertani csoportot, így hogy a T-rex szövet a strucc szövetére hasonlít és nem a kutyáéra az egy független megerősítés. Amúgy senki se állítja, hogy a madarak a T-rexekből fejlődtek volna ki. Közös ősről van szó, ahogy az Archaeopteryx esetében is. A gyíkmadárnak is a legtöbb bélyege rokonítja őt a mai madarakhoz, de van épp elég különbség ahhoz, hogy ne legyen az ősük. „mert az, hogy két dolog nagyon hasonlít nem bizonyítja, hogy a két dolog egymásból fejlődött ki. Logikailag nem következik egyik a másikból.” Akkor az apasági vizsgálat se állja meg a helyét? Van olyan fokú hasonlóság, amely kizárja, hogy ne legyen összefüggés.
    „Szívből kívánom, hogy megértsd mi vesz rá valakit, hogy a szerinted evidens dolgokkal is szembehelyezkedve egy értelmetlen hülyeségnek rendelje alá az életét.” Felőlem mindenki úgy pazarolja el az életét, ahogyan akarja, amíg nem árt vele másoknak. (Azaz, majdnem mindenki.) Nincs akkora egóm, hogy azt higgyem, én döntöm el mi értelmes vagy értelmetlen, vagy hogy amit én csinálok az értelmesebb lenne, mint amit más. Van olyan barátom, aki szerintem semmi értelmeset nem kezd az életével, de azt örömmel teszi, így ez engem sem zavar. Van, aki próbálkozik, de csak frusztrált lesz tőle. Van, aki szerint én se csinálok semmi értelmeset.
    2) Éva linkjére írtad: „inkább ne”. Miért is ne? A linken is azzal (is) érvelnek az evolúció ellen, mint Ádám, hogy milyen kicsi a valószínűsége funkcionális fehérjék létrejöttének. Amit amúgy cáfoltam, bár választ nem kaptam rá. Kb. az lenne a meglepő, ha egy 150 aa hosszú fehérje nem látna el bármilyen funkciót.
    3) Ádám: A sejtkiszúrós kísérlet azért hülyeség, mert a mai legprimitívebb prokarióta sejtekben is aktív transzporttal és szignál peptidek által vezérelve kerülnek a transzporteker a membránba, melyek a sejt szétesése után diffundálnak onnét. Azok már nem kerülnek vissza csak úgy. A szétesett sejtanyagban a fehérjék denaturálódnak és irreverzibilisen aggregálódnak (a megfelelő közeg illetve chaperonok hiányában és más fehérjékkel interakcióban), így működésképtelenné, sőt, toxikussá válnak. Ez a kísérlet annyira naiv, hogy aki felhozza az, Ádám szavaival, „Kategóriáhibát vét”. De inkább ne menjünk bele, hogy mi milyen „Kategóriáhibát vét”, mert az értelmetlenné tenné ezt az egész, fél éves beszélgetést.
    4) De legyen, nem vétek kategóriahibát, de attól még a logikátlanságodra felhívhatom a figyelmedet: „Nagy mennyiségű funkcióspecifikus komplexitás viszont csak intelligens okok hatására alakul ki.” Úgy érzem a saját világképeden belül nem állja meg a helyét ez az axióma, hisz a tervező Intelligencia maga is funkcióspecifikus komplexitás, nem igaz? Tehát intelligens ok hatására alakult volna ki?
    5) A Polányis linkedről: „Polányi rendkívül fontosnak tartja a tényt, hogy a kémiai törvények nem határozzák meg a nukleotidok sorrendjét.” „Mi következik ebből? Az, hogy a DNS-ben tárolt nagy mennyiségű információt nem a fizika és a kémia törvényei határozzák meg (noha azok által működik), hanem valamilyen felsőbb szint kontrollálja.” Igen, a felsőbb szint határozza meg, amit te is megneveztél, bár aztán többet nem beszéltél róla: a természetes szelekció. A nukleotidok sorrendje határozza meg a fehérjék aminosav sorrendjét, és ez illetve az aminosavak karaktere a fehérje tulajdonságait. A természetes szelekció elsősorban a fehérjékkel van kapcsolatban, kvázi kiválasztja a megfelelő fehérje-összetételű, tehát a túlélő egyedeket, melyeknek így a nukleotid sorrendje is megfelelő.
    Amúgy miért ne lehetne a fizikának és kémiának is több szintje? Lásd, pl a csillagokat, amiknek a működését önmagában nem magyarázza a hidrogén tulajdonsága, kell hozzá a hatalmas tömeg is.
    „A lényeg az, hogy a DNS-ben lévő információt nem a kémia és a fizika határozza meg.” Igen, ezért hívják ezt a tudományt biológiának. „ Ebből pedig az következik, hogy a biológiában a csak „bottom-up” (alulról felfelé) magyarázatok eleve rosszak. A génekből kiindulva nem lehet az életet megmagyarázni.” A szelekció, a felsőbb szint határozza meg a géneket, így nem annyira elvetélt ötlet ez. (Amúgy a természetes szelekció is fizika, kémia és biológia. A mesterségesben ott az ember is, gyorsabb is ezért.)
    6) Nézzünk egy gondolatkísérletet. Képzeljünk el egy viszonylag zárt rendszert, mondjuk egy barlangot, benne egy mélytengeri füstölgővel, ahol nagy számban keletkeznek RNS nukleotidok, amelyek összeállnak láncokká is, így akár, vagy hasonlóan: http://www.nature.com/articles/ncomms11328 . A rendszerbe membrán darabok is kerülnek, liposzómák, mondjuk a szomszéd füstölgőtől, és ezek magukba zárják az RNS láncokat. A milliárdnyi hasonló esemény közül az RNS nukleotidok egy RNS dependens RNS polimeráz aktivitású ribozimet vagy egy RNS ligáz aktivitású ribozimet jelentenek. A membránon át bejutnak a RNS nukleotid monomerek, dimerek, kisebb oligomerek, de a nagyobbak már nem jutnak ki, így a ligáz összeilleszti őket nagyobb oligomerekké, melyeknek lehet funkciója, pl polimeráz aktivitás, mely lemásolja ezeket a nukleotid láncokat. A növekvő sejtszerű képződmények szétválnak és új leánysejtekké állnak össze. Ez egy replikátor, mely több életfunkciót is mutat. Az osztódó, szaporodó replikátor egyes tagjaiban különböző ribozimek, RNS láncok alakulnak ki, melyek közül a sikeresek fennmaradnak, egyszerűen azért, mert több másolat készül róluk. Mutációk révén egyre hatékonyabbá válnak. A replikátorba majd DNS nukleotidok is bejutnak, melyeket a mutáns polimeráz felismer és így a replikátorban található ribozimeket átmásolja DNS kópiába is, melynek ugyan nincs aktivitása, hisz nem tudja felvenni a megfelelő térszerkezetet, de stabilabb,. Ez is előny. Kialakulnak az első mai gének, melyek RNS-t kódolnak, mint a mai tRNS, rRNS és miRNS gének, csak ezek az RNS-ek ribozimek. A különböző ribozimek DNS kópiái összetapadnak, ligálódnak egy DNS lánccá. Kialakul az első genom. A fehérjék kialakulása már trükkösebb. A ribozimek sok funkciót nem tudnak ellátni, ezek a replikátorok még igen érzékenyek, lényegében passzív rendszerek. Az első fehérjék talán transzporterek, melyek szabályozzák a nukleotidok membránon átjutását. Kötik a nukleotidokat, az aminosavak különböző affinitással tapadnak egyes nukleotidokhoz, így már jelen van egy primitív kód-kodon kapcsolat. (A kód eredetéről, illetve evolúciós érdekességek, elméletek: http://elte.prompt.hu/sites/default/files/tananyagok/ABiokemiaEsMolekularisBiologiaAlapjai/ch15s03.html ) A replikátorokba jutó fehérjékhez, aminosavakhoz a replikátorban már meglévő RNS láncok tudnak tapadni, a megfelelő struktúrával, így ezek az első tRNS-ek. A nukleotid – aminosav affinitás tükröződik a tRNS szerkezetében, mely egyre kifinomultabbá válik mutációk révén. Kezdetben persze csak pár féle aminosav van (erre utalnak jelek a kódszótárban), valószínűleg 4, párban a 4 féle nukleotiddal, mely később bővül, ahogy a kódszótárban is hasonló kóddal hasonló karakterű aminosavak helyezkednek el. A tRNS-ekről is készül DNS kópia, akárcsak a replikátor számára értelmes funkciót ellátó (pl kálciumot kötő 12-13 aminosav) aminosav-lánccal kötötten kialakuló nukleotid-láncról is, így kialakulnak az első fehérjekódoló gének.
    Lehet még ötletelni.

  • Gergely Erzsébet says:

    “……… Nincs akkora egóm, hogy azt higgyem, én döntöm el mi értelmes
    vagy értelmetlen, vagy hogy amit én csinálok az értelmesebb lenne, mint
    amit más. Van olyan barátom, aki szerintem semmi értelmeset nem kezd az
    életével, de azt örömmel teszi, így ez engem sem zavar. Van, aki próbál –
    kozik, de csak frusztrált lesz tőle. Van, aki szerint én se csinálok
    semmi értelmeset.
    ……………………………………………………………..”

    Kompetencia hiányában a poszt témájához hozzászólni nem tudok, de ha az
    élet értelmessége, hasznossága valahol felvetődik, mindig felidéz bennem
    egy kedves emléket.

    Idős gondozásban dolgoztam. Volt egy kedves diakonissza, aki életének te –
    vékeny szakaszát sérült és idős emberek szolgálatában töltötte, majd el –
    jött az idő, mikor őt gondozhattuk. Ezt nagyon nehezen viselte. Többször
    méltatlankodva kérdezte: – Mond Erzsi, mi értelme van ennek az életnek?

    Éjjeliszekrényén volt egy kopott kis tábla, amire a következő volt írva:
    “Nagy az ereje az igaz ember buzgó könyörgésének.” (Jakab levele 5:16)
    Kezembe vettem, feltettem a szemüvegét, elé tartottam, és lassan olvasta:
    .. Nagy .. az .. ereje .. az .. igaz .. ember .. buzgó .. könyörgésének.
    Időt hagytam, hogy szívében ismét felragyogjon a számára oly jól ismert
    mondat üzenete.

    Közösen csodálkoztunk rá arra, hogy az imádságban rejlő erőnek nem fel –
    tétele a kor és az egészségi állapot. Miután ez tudatosult benne, többet
    nem hallottam méltatlankodni. Sőt, időnként imatársul csatlakoztam hozzá.

  • Gergely Erzsébet says:

    “…………………………………………………………….
    “Nagy az ereje az igaz ember buzgó könyörgésének.” (Jakab levele 5:16)”
    …………………………………………………………….”

    Csak érdekességként.

    Most írta valaki, hogy e föntebb idézett igerésznek van egy még kifeje –
    zőbb fordítása is:

    “Nagyon hatékony az igaz ember buzgó imádsága.”

    Megnéztem az angol King James – ben, és ott az alábbi kifejezés olvasható:

    effectual = hatékony

  • Szabados Ádám says:

    Lima Rui,

    A sejtkiszúrós kísérlet azért hülyeség, mert a mai legprimitívebb prokarióta sejtekben is aktív transzporttal és szignál peptidek által vezérelve kerülnek a transzporteker a membránba, melyek a sejt szétesése után diffundálnak onnét. Azok már nem kerülnek vissza csak úgy.

    A kísérlet egy a forteriori érv (nem kategóriahiba): ha – ahogy te is mondod – a sejt szétesése után az alkotóelemek diffundálnak onnét, és azok már nem kerülnek vissza csak úgy, mennyivel inkább elképzelhetetlen, hogy ennél összehasonlíthatatlanul kedvezőtlenebb állapotból magától összeálljon egy önmagát replikálni képes élő sejt. Természetesen senki nem állítja, hogy az első élő sejt így állt össze. Akik az élet spontán létrejöttét vizionálják, ennél összehasonlíthatatlanul valószínűtlenebb folyamatot feltételeznek.

    De legyen, nem vétek kategóriahibát, de attól még a logikátlanságodra felhívhatom a figyelmedet: „Nagy mennyiségű funkcióspecifikus komplexitás viszont csak intelligens okok hatására alakul ki.” Úgy érzem a saját világképeden belül nem állja meg a helyét ez az axióma, hisz a tervező Intelligencia maga is funkcióspecifikus komplexitás, nem igaz? Tehát intelligens ok hatására alakult volna ki?

    Tegyük fel, hogy igazad van (nincs), és az érv a tervezőre is vonatkozik. Ebben az esetben mit bizonyítottál? Azt, hogy a Tervezőt is tervezték (akárki is volt). Ha a design filter létezik (létezik), akkor alkalmazni kell (az élet számos területén alkalmazzák is). Ha egy ókori felirat eredetét kutatod, és eljutsz a feltételezett szerzőhöz, miért zárnád ki mint okot, ha az ő eredetéről nem tudsz semmit? Ha egy számítógépes szoftver eredetét kutatod, és eljutsz a programozóig, kizárná vajon a szerepét, ha őt is valaki megalkotta? A tervező tervezettsége egyszerűen nem része a design filternek. Amikor pedig (utalva a világnézetemre) Istent tekinted a Tervezőnek (ami a természettudomány területéről a teológia vidékére visz át), egyszerűen kategóriahibát vétesz, ha rá is alkalmazod a filtert. Isten ugyanis definíció szerint keletkezés nélküli, a filter pedig csak a keletkezett dolgokra alkalmazható.

    A Polányis linkedről: (…) Igen, a felsőbb szint határozza meg, amit te is megneveztél, bár aztán többet nem beszéltél róla: a természetes szelekció. A nukleotidok sorrendje határozza meg a fehérjék aminosav sorrendjét, és ez illetve az aminosavak karaktere a fehérje tulajdonságait. A természetes szelekció elsősorban a fehérjékkel van kapcsolatban, kvázi kiválasztja a megfelelő fehérje-összetételű, tehát a túlélő egyedeket, melyeknek így a nukleotid sorrendje is megfelelő.

    Ez a neo-darwinista tézis, amelynek mechanizmusa magyarázatként elégtelen. A szelekció sem az első élő sejt keletkezését nem magyarázza (hiszen prebiotikus környezetben nincs természetes szelekció), sem az új élőlények megépüléséhez szükséges információ keletkezését.

    A szelekció, a felsőbb szint határozza meg a géneket, így nem annyira elvetélt ötlet ez. (Amúgy a természetes szelekció is fizika, kémia és biológia. A mesterségesben ott az ember is, gyorsabb is ezért.)

    Örülök, hogy te is elveted a fizikai redukcionizmust és a géncentrikus neo-darwinizmust. Attól tartok, a természetes szelekció azonban kevés lesz a biológiai rendszerek létrejöttének magyarázataként. A szelekció csak a létrejött változatok között tud szelektálni. Vagy visszanyúlsz tehát ahhoz a magyarázathoz, hogy véletlen genetikai mutáció hozza létre a változatokat, vagy új mechanizmust kell kidolgoznod. A matematika így is, úgy is megkerülhetetlen lesz.

    Nézzünk egy gondolatkísérletet.

    A gondolatkísérletedről Chesterton utópiákról szóló bölcs mondása jutott eszembe: „Minden utópiák gyengéje ez: feltételezik, hogy az emberrel kapcsolatos legnagyobb nehézség legyőzhető, s aztán részletesen beszámolnak arról, hogyan lehetne a kisebb nehézségeket legyőzni.” A gondolatkísérletedben olyan lépéseket feltételezel, amelyek valószínűsége a nullával egyenlő. Elegánsan átlépsz a problémák felett, majd azt mondod: íme az élet eredetének egy plauzibilis magyarázata. Nem látom annak.

  • Lima Rui says:

    Ádám:
    Nagyon kötöd az ebet a karóhoz a sejtkiszúrós elmélettel kapcsolatban. A fehérjék összecsomósodnak és torz konformációt vesznek fel a kiszúrás után, az már nem tud helyreállni. Ezek irreverzibilis folyamatok.
    Ez a filterezés elég önkényes dolog. Ha a Tervezőre, akár Isten, akár valami más, akár definíció, akár filter szerint nem áll a mondatod („Nagy mennyiségű funkcióspecifikus komplexitás viszont csak intelligens okok hatására alakul ki.” ), akkor az nem is igaz. Ilyen erővel az élet keletkezését is belefilterezhetnéd.
    “(hiszen prebiotikus környezetben nincs természetes szelekció)” Szóval molekulákra nem hatnak a fizika és kémia törvényei, mely alapján egyes molekulák eltűnnek, mások felsokszorozódnak? Ezt át kéne gondolnod.
    ” A szelekció csak a létrejött változatok között tud szelektálni. Vagy visszanyúlsz tehát ahhoz a magyarázathoz, hogy véletlen genetikai mutáció hozza létre a változatokat, vagy új mechanizmust kell kidolgoznod.” Az első prebiotikus molekulák, vagy az első sejt előtti replikátorok létrejötténél a molekulák összeállása eleve nagyságrenddel nagyobb változatosságot eredményez, mint a mutációk önmagukban. Van miből válogatni a szelekciónak.
    “A gondolatkísérletedben olyan lépéseket feltételezel, amelyek valószínűsége a nullával egyenlő. ” Pl? Persze feltételeztem a reakciók számára kedvező környezetet, amiről nem mutattam meg, hogy létezhet e egyáltalán. Ezért csak egy gondolatkísérlet. De ha ezen átlendülsz, és elképzelsz egy olyan helyzetet, ahol nukleotid láncok, aminosavak és membránok keletkeznek, nem mind egyszerre, hanem 100 millió év során, lépésenként, persze az előző lépések, így a környezet állandósulolásával együtt, akkor mit szólsz hozzá? Nem mondtam, hogy ez egy tudományos elmélet vagy modell lenne.

  • Szabados Ádám says:

    Lima Rui,

    Nagyon kötöd az ebet a karóhoz a sejtkiszúrós elmélettel kapcsolatban. A fehérjék összecsomósodnak és torz konformációt vesznek fel a kiszúrás után, az már nem tud helyreállni. Ezek irreverzibilis folyamatok.

    Ami nem tud helyreállni, az miért tudott volna eredetileg létrejönni? Érdekes, hogy itt látod a nehézséget, amikor elméleteket gyártasz, akkor meg nem. A kísérlet felvetése pont erre mutat rá.

    Ez a filterezés elég önkényes dolog. Ha a Tervezőre, akár Isten, akár valami más, akár definíció, akár filter szerint nem áll a mondatod („Nagy mennyiségű funkcióspecifikus komplexitás viszont csak intelligens okok hatására alakul ki.” ), akkor az nem is igaz. Ilyen erővel az élet keletkezését is belefilterezhetnéd.

    Ezt a gondolatmenetedet egyáltalán nem értem. A „filterezés” (ahogy nevezed) nem önkényes dolog. Különböző tudományágak naponta használják. A biológiában is érvényes, csak azok tiltják meg a használatát az élet teleológiai, információvezérelt rendszerei kapcsán, akik naturalista filozófiai előfeltevésekkel művelik ezt a tudományt. Hadd idézzem megint Ernst Chain Nobel-díjas biokémikust: „Azt mondani, hogy élő szervezetek nem maradnak élve, ha nem alkalmasak a túlélésre, közhely, nem pedig tudományos elmélet. Az, amit a 19. század végi pozitivisták és azok követői állítottak, hogy a legalkalmasabb fennmaradása és fejlődése teljes mértékben véletlen mutációk következménye, vagy akár az, hogy a természet mutációk általi próba-szerencse kísérleteket végez, hogy a fennmaradásra alkalmasabb élő szervezeteket alkosson, olyan hipotézisnek tűnik számomra, melyre nincs bizonyíték és összeegyeztethetetlen a tényekkel. Ez a hipotézis szándékosan figyelmen kívül hagyja a teleológiai szándék elvét, mely ott van a biológus szeme előtt, bármerre is néz, akár egy szervezet különböző szerveit kutatja, akár ugyanazon a sejten belül a különböző elemek egymáshoz való viszonyát, vagy akár különböző fajok egymással való kapcsolatát és interakcióját. Ezek a klasszikus evolúcióelméletek nagy mennyiségű összetett és finom tény leegyszerűsítései, megdöbbent, hogy mennyi tudós, milyen hosszú ideje, mennyire kritikátlanul és készségesen nyeli be, bármiféle tiltakozás vagy morgás nélkül.” (Chain: “Social Responsibility”, 367)

    “(hiszen prebiotikus környezetben nincs természetes szelekció)” Szóval molekulákra nem hatnak a fizika és kémia törvényei, mely alapján egyes molekulák eltűnnek, mások felsokszorozódnak? Ezt át kéne gondolnod.

    Te is jól tudod, hogy természetes szelekcióról csak ott beszélhetünk, ahol önmagukat reprodukálni képes élő szervezetek küzdenek a túlélésért. „A prebiotikus evolúció önellentmondás.” (Theodosius Dobzhansky) Az általad említett prebiotikus molekulák összeállása véletlenszerű, teljesen nélkülözik a valódi replikátorok jellegzetességeit. Még egy vírus sem képes élő sejt nélkül önmagát lemásolni.

    Az első prebiotikus molekulák, vagy az első sejt előtti replikátorok létrejötténél a molekulák összeállása eleve nagyságrenddel nagyobb változatosságot eredményez, mint a mutációk önmagukban. Van miből válogatni a szelekciónak.

    Könyörgöm, milyen szelekciónak?

    De ha ezen átlendülsz, és elképzelsz egy olyan helyzetet, ahol nukleotid láncok, aminosavak és membránok keletkeznek, nem mind egyszerre, hanem 100 millió év során, lépésenként, persze az előző lépések, így a környezet állandósulolásával együtt, akkor mit szólsz hozzá?

    Nem tudok átlendülni rajta. Számomra ez elképzelhetetlen.

  • dzsaszper says:

    Kedves Lima Rui,

    Igen, a felsőbb szint határozza meg, amit te is megneveztél, bár aztán többet nem beszéltél róla: a természetes szelekció.

    A felsőbb szint természetes szelekcióval való azonosítása vajon
    – magánvélemény?
    – hipotézis úgy általában? egyáltalán, kinek a hipozézise?
    – természettudományos hipotézis? Mit állít ez a hipotézis, hogyan falszifikálható reprodukálható kisérletekkel?
    – tényállítás? mi alapján

    Egyelőre a dolog így lóg a levegőben, minden referencia nélkül…

    Ami a kategóriahibát illeti, ajánlom, mélyedj el egy kicsit a klasszikus filozófiában…

  • istván says:

    Kedves Lima Rui!

    “Számtalan bizonyíték szól a madarak és a dínók rokonsága mellett, sőt, hogy az előbbiek az utóbbiak leszármazottai.”

    épp ezt próbáltam elmagyarázni, hogy nincs ilyen bizonyíték. tények vannak, amiket te így értelmezel.
    az apasági vizsgálat esetén vannak olyan tények amelyeket közvetlenül meg tudunk figyelni, pl.: a férfi és a nő beszámol róla, hogy szexuális kapcsolatot létesítettek, ennek az eredményét tudjuk vizsgálni a genetika módszereivel. Konkrétan meg lehet mondani valakiről, hogy nem lehet a gyerek apja. Ez tudomány, mert empirikus, tényeken alapul és reprodukálható.
    A dinoszauruszok és a madarak rokonsága közvetett megfigyeléseknek az egyik lehetséges értelmezése, az hogy te pont ezt az értelmezést fogadod el az hit. ettől még lehet igaz, de semmiképpen sem lehet tény.

    inkább ne
    azért ne, mert már a szó maga is önellentmondás. a fentebb vázolt kritériumokba nem igazán tud bele esni a teremtés vizsgálata. ettől még lehet vizsgálni, gondolkozni róla és a Szentlélek egészen valóságosan meggyőzi az embert arról, hogy a látható világ a láthatatlanból állt elő, de ez nem tudomány ez fölötte áll a szűk tudományos eszköztárnak.
    A kettő összekeverése pedig káros, mind a hit számára, mind a kereszténység számára, mind a logikus gondolkozás számára.

    Kedves Ádám!

    félreérted, hogy mi kedvező és mi nem az.
    egy mai sejt kiszúrása sokkal kedvezőtlenebb körülményt teremt, hiszen ez a rendszer ahogy te is írtad magas fokú szervezettséggel bír, ha kiszúrod pont ez vész el belőle.
    ennél kedvezőbb az az állapot, ahol fejletlenebb, egyszerűbb molekulák építenek föl egy rendszert, sokkal egyszerűbb reakciókat katalizálva. az elméletek szerint ezeknek a rendszereknek nem kell akkora információ mennyiség a szerveződéshez.
    de ezzel megint ott vagyunk a vitában ahol a part szakad

    A prebiotikus szelekcióra ehhez hasonló példát szoktak felhozni:
    vannak lipidek, amik vízben micellákat hoznak létre, ezek kicsik.
    ha a micella a környező oldatból oldott anyagot zár magába, akkor nő a térfogata.
    ha a magába zárt anyag RNS nukleotid, vagy önreplikáló RNS molekula (ha most elveszel az ellenérvek és ellenérzéseid mélységes mély kútjában, akkor fölöslegesen írom le a többit. ezeket félre kell tenni ilyenkor, hogy párbeszéd képesek legyünk) akkor az egyszerű membránon átjutó további nukleotidok polimerekké alakulhatnak.
    a polimer nagy, a nukleotid kicsi. A polimer nem tud kijutni a membránból, a nukleotid még ki-be tud diffundálni.
    a membránon belüli oldott anyag koncentráció növekedése magával vonja, hogy az oldat is a membránon belülre diffundál(ozmózis).
    ettől az egész micella felfúvódik. A micellák össze is tudnak olvadni, ne feled nem kettős lipid rétegről van szó.
    A lényeg, hogy egy bizonyos mérettartomány fölött az egész nem stabil és több kisebb darabra hasad. azok fognak tovább nőni, amelyekben van varázsmolekula, ami képes polimereket előállítani.
    ugyanez igaz a “fehérjékre” is. az aminosavak ha polimerizálódnak, akkor nehezebben jutnak ki a micellából, viszont növelik az ozmózis mértékét, ettől gyorsabban hízik a micella, hamarabb szakad több darabra.
    szerintem ez logikus és lehetőséget biztosít a szelekcióra. erre gondolnak az evolúció hívők amikor prebiotikus evolúciót és RNS világot emlegetnek.
    ha erre azt mondod, hogy érdekes elmélet, lehetséges, hogy így volt, akkor utána át lehet térni fontosabb dolgok megbeszélésére, mert ennél többet ők sem tudnak ehhez hozzáfűzni. ne adjuk meg azt az örömöt a sátánnak, hogy lényegtelen dolgok megcáfolásába és vitatkozásba fektetjük az időnket és az erőnket.

    egyébként az a gond, hogy igazából szerintünk nincs irányítatlan anyagi folyamat, Lima Rui szerint pedig csak olyan van.
    egyszerűen nincs átjárás a két gondolatrendszer között. az egyetlen lehetőség az értelmes párbeszédre, ha átmegyünk lövészárok látogatóba. ezt te részben megtetted, bár szerintem nem teljesen objektívek a következtetéseid. nagyjából értem is, hogy miért.
    ha Rui nem akarja őszintén, objektíven és alaposan megvizsgálni a mi gondolatrendszerünket, akkor csak a billentyűzetet koptatjuk el végeredményként

  • Szabados Ádám says:

    istván,

    akkor a párbeszéd kedvéért: érdekes elmélet.:) Csak a szememben tökéletesen implauzibilis az élet eredetének magyarázataként.

    A két gondolatrendszer között szerintem metafizikai előfeltevések szintjén nincs átjárás (Lima Rui materialista/naturalista, én teista és keresztény vagyok, és ha jól értem, te is az vagy), a valóság megismerése tekintetében viszont van átjárás, hiszen ugyanazokra az adatokra nézünk rá. Ebben az értelemben tehát egyszerre van és nincs objektivitás.

    A Polányi és mások által megfogalmazott poszt-kritikai realizmus számomra tudományfilozófiai iránytű: minden tudományos megismerés személyes, de minden megismerés a valósággal való kontaktus, ami ezért validálható. Minden tudós fiduciáris (hit) keretekben dolgozik, és minden ismeret előzetes (preliminary). Tud tehát beszélgetni teista és ateista, csak őszintének kell lenniük a nézőpontjukkal és az előfeltevéseikkel kapcsolatban. Ez különösen igaz a történeti tudományok esetében, amilyen az evolúcióbiológia.

  • Szabados Ádám says:

    istván,

    egy gondolatot még engedj meg ahhoz kapcsolódóan, amit arról írsz, hogy a kezdeti állapot kedvezőbb volt, mint a sejt diffundálódott alkotóelemei helyreállásának lehetősége a kémcsőben. Végső soron így is, úgy is meg kell épülnie az első prokarióta sejtnek, amihez szükség van az információra, a fehérjékre, a membránra, a rendkívül komplex és magasan szabályozott rendszerszintű funkcionalitásra. Nem tudom, miért gondolod, hogy könnyebb ennek kis lépésekből megépülni, mint a meglévő akotóelemekből helyreállni. Miért lenne könnyebb egy egyszerű órát a szélnek, napsütésnek, és egyéb fizikai és kémiai erőknek a nulláról összerakni (megalkotni egyenként az összes alkotóelemet, majd azokat rendszerré építeni össze), mint újra működőképes órává tenni azt az órát, ami szétesett? Tudom, az analógia több ponton sántít, de nem látom racionálisabbnak azt sem, hogy a szétesett sejt helyreállásánál könnyebb volna az irányítatlan fizikai és kémiai folyamatoknak apró lépésekben megépíteni az első élő sejtet.

    Ha a legegyszerűbb élő sejtekben is jelen lévő funkcióspecifikus információt apró lépésekben akarod összerakni, szükséged van teleológiai szándékra (ami a vak órásmester evolúció esetében ugye nincs), és/vagy olyan szerencsesorozatra, ami ahhoz hasonlít, mint ha egész életedben megnyernéd az összes lottóötöst minden egyes sorsoláson. Ez nem plauzibilis. De miért feltételeznénk, hogy az egyszerűből a komplexebb felé fog menni a folyamat, amikor univerzális tapasztalatunk (amit a termodinamika második törvénye is leír), hogy a rendezett állapotból a rendezetlen felé haladnak a magukra hagyott dolgok? Ezért tartom szemléletesnek a kémcsőben kiszúrt sejt hipotetikus kísérletét. Mivel nem egy múltban feltételezett, irreálisan optimista (a valós tapasztalatainknak könnyen ellentmondó, mert ellenőrizhetetlen) forgatókönyvről van szó, hanem olyan folyamatról, ami a szemünk előtt mehet végbe, a kísérlet jól szemlélteti, hogy az irányítatlan természeti folyamatok mire képesek és mire nem. A teleológiai rendszerek és a funkcióspecifikus információ oka univerzális tapasztalatunkban mindig a tervező intelligencia. A kémiai evolúció hívei a tudományos-fantasztikum világában bolyonganak, nem a tudományéban.

  • istván says:

    “a valóság megismerése tekintetében viszont van átjárás, hiszen ugyanazokra az adatokra nézünk rá. Ebben az értelemben tehát egyszerre van és nincs objektivitás.”

    Átjárási lehetőség van, csak szoros a kapu és keskeny az út. önerőből pedig senki sem fog szabadulni a saját maga igazságától és az ennek megfelelő értelmezési kerettől.

    “minden tudományos megismerés személyes…”

    hát igen jó lenne, ha ez átmenne a tudatos szintre is

    “akkor a párbeszéd kedvéért: érdekes elmélet.:)”

    idáig tetszik

    “Csak a szememben tökéletesen implauzibilis az élet eredetének magyarázataként.”

    innentől ez csak egy véleménynek hat, mert a legtöbb tudós szakbarbár. ha materialista lennék azt mondanám, hogy talán implauzibilis, de a tény hogy mégis itt vagyunk azt igazolja, hogy a nagyon valószínűtlen mégis bekövetkezett. az elmélet viszont ugyanúgy nem nyert cáfolást.
    az igazi probléma az, hogy sem empirikus, sem racionális alapon nem tudunk jobbat mondani ennél (na jó, racionális alapon még talán lehetne. azt persze ők sem veszik észre, hogy már messze túl vannak az emp