Orosz tudósok nemrégiben egy távoli naprendszerből érkező jelet fogtak. A Zelencsukszkajában észlelt „erős jelek” felkeltették a SETI (Search for Extraterrestrial Intelligence) kutatóinak a figyelmét is, és bár Seth Shostak, az intézet vezetője óva int attól, hogy túl hamar földönkívüli intelligenciára következtessünk, a lehetőséget a kutatók nagyon komolyan vizsgálják. A hír bejárta a magyar és a nemzetközi sajtót is. Engem őszintén szólva nem önmagában a hír érdekel, mert meglehetősen szkeptikus vagyok a földönkívüli élet lehetőségével kapcsolatban, és azt valószínűsítem, hogy a mostani szenzáció ugyanúgy csalódást kelt majd, ahogy korábbi esetekben. A földönkívüli intelligencia lehetőségéről szóló hírt más miatt tartom érdekesnek.

Azért érdekes számomra a hír, mert mindenki magától értetődének tartja, hogy bizonyos jelenségek észlelésekor intelligens okra következtethetünk. Akkor is, ha a feltételezett intelligenciáról semmiféle ismeretünk nincsen. Mind az orosz tudósok (a jelet az Orosz Tudományos Akadémia RATAN-600 nevű teleszkópja észlelte), mind a SETI, mind a nemzetközi tudós társadalom és a média teljesen legitim tudományos tevékenységnek tartja az intelligens ok kutatását. Hogy a kutatók szerint miért következtethetünk (vagy inkább csak következtetnénk) bizonyos jelek esetében intelligens okra? Azért, mert tudjuk, hogy egyes jelenségek magyarázataként nem jöhetnek szóba irányítatlan anyagi folyamatok, csakis intelligencia. Ilyen például a prímszámok felsorolása, amit ha a SETI programok nagy teljesítményű technikai eszközei észlelnének, azonnal tudnánk, hogy földönkívüli intelligenciára bukkantak. Annak a matematikai valószínűsége, hogy véletlenszerű anyagi folyamatok egymás mellé rakjanak egy ilyen számsort, a nullával egyenlő, ezért kizárható.

És hogy ez miért érdekes? Azért, mert a biológiában ugyanezt az érvelést sokan mégsem tartják legitimnek. Különböző okokból a biológus társadalom jelentős részét olyan világnézet köti gúzsba, amely kizárólag irányítatlan anyagi folyamatokat hajlandó figyelembe venni a biológiai jelenségek magyarázataként. Pedig az élet rendszereiben – a legegyszerűbb sejtben is – a prímszámok sorrendjénél összehasonlíthatatlanul komplexebb, funkcionális információ található, amely magyarázataként más esetben kizárólag intelligenciát feltételeznénk (akkor is, ha az adott intelligenciáról semmit nem tudunk). A kérdés ezért nem az, hogy az élet jelei intelligens okra mutatnak-e (ha a SETI logikáját követjük, nyilvánvalóan igen), hanem az, hogy a tudós társadalom miért vonja le ezt a következtetést sokkal könnyebben, ha esetleges földönkívüli lényekről van szó, mint akkor, ha a jelek a Teremtő irányába mutatnak.

43 hozzászólás a “Intelligens okok az univerzumban?” bejegyzéshez

  • tothaa says:

    A nulla nekem még mindig:
    ha valaminek a matematikai valószínűsége nulla, attól az még nem biztos, hogy kizárható!
    De mindenképpen egyetértek e cikked által bemutatott ambivalenciával a tudós világról.

  • Szabados Ádám says:

    Aminek nagyjából nulla a valószínűsége, azt a komolyan vehető magyarázatok közül kell csak kivenni, de onnan ki kell venni, ha a tudományos ésszerűség területén járunk.

  • Lima Rui says:

    A SETI és a teleszkópok által észlelt jelek csupán elektromágnesesek, mely eleve behatárolja a jel információtartalmát. Ezek a jelek, ha nem egyszeriek, akkor erősen redundánsak, hisz a jeladó objektum, és itt most egy exobolygóra gondolok, keringési és/vagy forgási idővel rendelkezik, esetleg pulzálással, vagy fokozatos halványulással illetve az észlelővel bezárt szöggel, melyek csillagászati skálán állandóak, így a jel egy ritmussal rendelkezik, alacsony információtartalommal. Viszont maga az objektumnak hatványozottan nagyobb az információtartalma: a bolygó tömege, átmérője, hőmérséklet, légköri nyomás, ha van egyáltalán, milliónyi vegyület, a körülötte keringő hold(ak) és egymásra hatásuk, gyűrűk vagy meteorok, kőzetbolygónál a felszíni formációk: hegyek, kráterek, nem beszélve esetleges életről. Az űrből érkező elektromágneses jelek információtartalma elenyészően kevés a kibocsátó objektuméhoz képest. Maga a Föld bolygó az eszméletlenül nagy komplexitásával sem bocsát ki magából prím számokat tartalmazó kódolást, a távolból csak egy halvány, unalmas pötty az égen.

  • Lima Rui says:

    Az utolsó mondatom a Föld 100 évvel ezelőttig tartó állapotára utalt. Közel 4 milliárd évig nem távozott semmi jel a Földről, ami az életre utalna és ebből az utóbbi 3 millió évben már intelligencia is jelen volt itt, nem beszélve az utóbbi 50 ezer évről. Micsoda hatalmas komplexitás, miközben egy halvány pötty az űrben, mely X periódussal kitakarja a kis sárga központi csillagát.

  • Szabados Ádám says:

    Hogy kapcsolódik a hozzászólásod a cikk tartalmához?

  • Lima Rui says:

    “Azért érdekes számomra a hír, mert mindenki magától értetődének tartja, hogy bizonyos jelenségek észlelésekor intelligens okra következtethetünk.”
    “egyes jelenségek magyarázataként nem jöhetnek szóba irányítatlan anyagi folyamatok, csakis intelligencia. Ilyen például a prímszámok felsorolása, amit ha a SETI programok nagy teljesítményű technikai eszközei észlelnének, azonnal tudnánk, hogy földönkívüli intelligenciára bukkantak. Annak a matematikai valószínűsége, hogy véletlenszerű anyagi folyamatok egymás mellé rakjanak egy ilyen számsort, a nullával egyenlő, ezért kizárható.

    És hogy ez miért érdekes? Azért, mert a biológiában ugyanezt az érvelést sokan mégsem tartják legitimnek. Különböző okokból a biológus társadalom jelentős részét olyan világnézet köti gúzsba, amely kizárólag irányítatlan anyagi folyamatokat hajlandó figyelembe venni a biológiai jelenségek magyarázataként.”
    És itt a lényeg:
    “Pedig az élet rendszereiben – a legegyszerűbb sejtben is – a prímszámok sorrendjénél összehasonlíthatatlanul komplexebb, funkcionális információ található, amely magyarázataként más esetben kizárólag intelligenciát feltételeznénk (akkor is, ha az adott intelligenciáról semmit nem tudunk). A kérdés ezért nem az, hogy az élet jelei intelligens okra mutatnak-e (ha a SETI logikáját követjük, nyilvánvalóan igen), hanem az, hogy a tudós társadalom miért vonja le ezt a következtetést sokkal könnyebben, ha esetleges földönkívüli lényekről van szó, mint akkor, ha a jelek a Teremtő irányába mutatnak.”
    Az érvelésed szerint a tudósok szerint a komplexitás intelligenciát jelent a csillagászatban, de a biológiában hasonló érvelés mentén a komplexitásnál elvetik az intelligenciát. Viszont a prímszámok nem hasonlíthatóak össze az élettel. A prímszámoknak teljesen más a komplexitása, nem lehet véletlenszerű azok eredete. Ezért fejtegettem, hogy a csillagok közül jövő jelek valójában rendkívül egyszerűek, az azokban megbúvó esetleges információ rejthet komplexitást, de az csak olyan jeleknél állapítható meg, mint pl a prím számok, melyek mögött valószínűleg értelem állhat, hisz az egy olyan sorozat, melynek tagjai, jelenlegi tudásunk szerint, véletlenszerűen jönnek egymás után, de mégis hasonlóak, mind prímek. A jelentéktelen fényforrásként pislákoló Földről jövő jel nem komplex, mégis nagy komplexitás van a Földön. A WTF-csillagtól ( http://index.hu/tudomany/2016/08/22/egyre_furabb_a_legfrissebb_csillagaszati_rejtely/ ) jövő jelek igen komplexek, akár köze is lehet intelligenciához, de mégsem kommunikáció, az információtartalma véletlenszerű. A prímszámokkal küldött jel kommunikációt jelentene, pedig nem komplexebb önmagában, mint a WTF-csillagtól jövő jel, csak az egyetlen ismert magyarázat rá intelligencia lenne. Szóval arra akartam itt utalni, csak lehet hogy elvesztem az okfejtésben, hogy a gondolatmeneted hibás. Párhuzamot vonsz 2 jelenség és azok magyarázataa közt, miközben nincs kapcsolat.

  • Szabados Ádám says:

    OK, így már értem. De félreértesz engem. Nem a komplexitás esetében feltételezünk intelligenciát, hanem a komplex, funkcionális információ esetében. A komplexitás és a funkcionálisan specifikus komplexitás közötti különbséget itt magyarázom el.

  • endi says:

    Nincs olyan, hogy nem intelligens jel. Sőt, semmi sincs ami nem intelligens. Aki hisz bármiféle véletlenben, az ne hivatkozzon semmiféle tudományra, semmiféle logikára, semmiféle értelemre. Nincs véletlen.

  • brabant89 says:

    Már hogyne létezne véletlen. A kvantummechanika arról szól, hogy az atomoknál kisebb részecskék esetében csak valószínűség létezik.

  • Ádám, nagyon érdekes ellentmondásra mutatsz rá, gratulálok.

    Valóban különös prekoncepció az, amelyik egyfelől SEMMIKÉPP sem hajlandó intelligenciát látni az intuitíve intelligensnek tűnő jelenségekben, ha a földi Életről van szó, de MINDENKÉPPEN intelligenciát akar felfedezni az intuitíve nem intelligensnek tűnő jelenségekben, ha az űrbeli élettelenségről van szó.

    A Isten-fóbiás tudósok úgy viselkednek, mint ha Hercule Poirot magabiztosan kijelentené, hogy akinek látszólag kés áll ki a hátából, annak az ügyében mindig természetes halálokot kell feltételezni, akibe meg látszólag villám csapott bele, annál mindig szándékos elkövetőt kell keresni. 🙂 Ez ma a trendi nem hívő hozzáállás.

    Ilyen csacska, elfogult és prekoncepciózusan „gondolkodó” az az embertípus, amelyik magát tartja az intelligencia csúcsának.

  • brabant89 says:

    A kérdés ezért nem az, hogy az élet jelei intelligens okra mutatnak-e (ha a SETI logikáját követjük, nyilvánvalóan igen), hanem az, hogy a tudós társadalom miért vonja le ezt a következtetést sokkal könnyebben, ha esetleges földönkívüli lényekről van szó, mint akkor, ha a jelek a Teremtő irányába mutatnak.

    Tudjuk, hogy kb. 100 éve, a rádiózás beindulása óta a Föld speciális, nem természeti eredetű elektromágneses sugárzást bocsát ki. Bár nem vagyok csillagász, hanem csak laikus, de amennyiben jól tudom, nagy mennyiségű elektromágneses sugárzást nem a bolygók, hanem a csillagok bocsátanak ki. Ezért aztán, tudva azt, hogy a Földről az emberi civilizáció bocsát ki elektromágneses hullámokat (elsősorban rádióhullámokat), logikus a feltevés, hogy más BOLYGÓKRÓL származó elektromágneses hullámoknak szintén technikai civilizáció lehet a forrása. Hangsúlyozom a technikai civilizációt, ugyanis nem az intelligencia sugároz, hanem a technikai civilizáció. Azért is gondolják így, mert mára tudjuk, hogy a Föld, a Naprendszer, a Tejútrendszer a világegyetemben nem foglalnak el középponti helyet, ezért feltételezik, hogy a milliárdnyi galaxisban számtalan olyan bolygó lehet még, amely alkalmas az életre. Tehát szerintem itt elsősorban nem arról van szó, hogy intelligens okot keresnek valamilyen jel mögött, hanem épp azért, mert tudjuk, hogy az emberiség produkál ilyen jellegű jeleket, feltételezzük, hogy ha máshol ilyet találunk, amögött is technikai civilizáció áll.
    Azt, hogy létezik-e Teremtő, azt viszont nem tudhatjuk. Sok érv szól létezése ellen, legelsősorban az, hogy sehol nem tudjuk megtapasztalni. Aztán persze sok más tényező is szól ellene. Például az ID elmélete feltételezi, hogy a sejtekben levő információt valaki belehelyezte a sejtbe. (Bár te mindig csak a tervezésről beszélsz, de a tervezés önmagában nem elég, annak a megtervezett információnak valahogy bele is kell kerülnie a sejtbe.) Mivel az egyes fajok DNS-e különbözik, akkor ebből az következik, hogy a tervező/megvalósítónak minden valaha élt fajt külön meg kellett teremtenie, (elhelyezni benne a korábban létezettektől különböző DNS-t) mégpedig olyan módon, ami folyamatos fejlődés benyomását kelti. Ez azt jelenti, hogy a Teremtő mintegy milliárd éven keresztül csodákkal folyamatosan beleavatkozott a földi élet (mikroorganizmusok, növények, állatok) alakulásába.
    Ezzel az állandó beavatkozással nehezen egyeztethető össze az, hogy míg a tervező/végrehajtó rendszeresen új és új állat- és növényfajokat hoz létre, addig a fontos kinyilatkoztatását nem teszi elérhetővé az egész emberiség számára, annak terjesztésében nem vállal szerepet, hanem az emberekre bízza azt, és amikor már több, mint kétezer év eltelt, akkor sem igazítja a mindenkori emberek felfogóképességéhez üzenetét.
    Ez számomra nagyon nagy ellentmondás, ami nem a Teremtő irányába mutat, hanem épp ellenkezőleg.

  • Szabados Ádám says:

    brabant89,

    érzésem szerint kicsit összekeverednek a hozzászólásodban a természettudományos és a teológiai érvek, de megpróbálok válaszolni.

    Tehát szerintem itt elsősorban nem arról van szó, hogy intelligens okot keresnek valamilyen jel mögött, hanem épp azért, mert tudjuk, hogy az emberiség produkál ilyen jellegű jeleket, feltételezzük, hogy ha máshol ilyet találunk, amögött is technikai civilizáció áll.

    A SETI csillagászai és kutatói sokféle program alapján kutatnak földönkívüli intelligencia után. Ezek egyike a nagy mennyiségű komplex, specifikus információ detektálása. Egy hosszú számsor komplex információ. Egy hosszú prímszámsor komplex, specifikus információ. Előbbit irányítatlan anyagi folyamatok is tudnak produkálni, utóbbit csak intelligencia (a matematikai probabilitás miatt), ezért ha az utóbbira bukkannak, akkor intelligens okot feltételeznek a rádióhullámok mögött. Ezt tartom analógnak az életet vezérlő nagy mennyiségű komplex, specifikus információval.

    Az biztos, hogy az élet rendszereiben ott van ez az információ. Hogy hogyan, mikor és hányszor került az információ az élet rendszereibe, az hasznos és izgalmas tudományos projekt, én most még biztosan nem tudnék válaszolni a kérdésre. Viszont nem biztos, hogy jó a kérdésed, mert azt feltételezi, hogy a sejt létezett és abba került az információ. A helyzet azonban fordítottnak tűnik: maga az anyag rendeződik információ alapján, a sejt pedig komplex, funkcionálisan specifikus információ alapján.

    Tegyük fel, hogy látsz egy számítógépet, amit szoftver irányít, és azon kezdesz gondolkodni, hogy vajon mikor került az információ a szoftverbe és pontosan hogyan cselekedett az intelligencia, amely a számítógépeket az információval ellátta, különös tekintettel azokra a számítógépekre, amelyek olyan szoftverrel rendelkeznek, amely képes öntanító folyamatokra. Majd kétségek támadnak benned az intelligenciával szemben, mert a világ nagyobb részében nem léteztek számítógépek, mert a gyerekek nem tudnak semmit a programozásról, és mert mi sem tudunk semmit a programozókról, akik az információt a rendszerekbe vitték. Szerintem a kétséged nem volna ésszerű.

    Azt, hogy létezik-e Teremtő, azt viszont nem tudhatjuk. Sok érv szól létezése ellen, legelsősorban az, hogy sehol nem tudjuk megtapasztalni.

    De hát ez nem igaz! Több milliárd ember tapasztalja őt. Én is tapasztalom őt, a barátaim közül is sokan tapasztalják őt. A tapasztalatom annyira erőteljes, hogy időnként a tudományos ellenérvek ellenére is ragaszkodom (ragaszkodunk) hozzá. Szcientista tévedés azt gondolni, hogy valódi ismerethez csak a tudományos módszer vezet el. A megismerésnek sok útja van, a tudományos módszer csak az egyik. A tudományos módszer komoly hátrányokkal bír számos területen. E. Schrödinger írta például: „Megdöbbent, mennyire hiányos az engem körülvevő valódi világról megrajzolt tudományos kép. Rengeteg tényszerű információt közöl, a tapasztalatainkat lenyűgöző rendszerbe szedi, azonban rémesen hallgat minden olyan dologról, ami igazán közel van a szívünkhöz, ami ténylegesen számít. Egy szót nem mond a pirosról és kékről, a keserűről és édesről, a fizikai fájdalomról és fizikai élvezetről; semmit nem tud a szépről és a csúnyáról, Istenről és az örökkévalóságról. A tudomány néha úgy tesz, mintha ezeken a területeken is lennének válaszai, de a válaszok időnként annyira ostobák, hogy nem is jut eszünkbe komolyan venni azokat.”

    Ezzel az állandó beavatkozással nehezen egyeztethető össze az, hogy míg a tervező/végrehajtó rendszeresen új és új állat- és növényfajokat hoz létre, addig a fontos kinyilatkoztatását nem teszi elérhetővé az egész emberiség számára, annak terjesztésében nem vállal szerepet, hanem az emberekre bízza azt, és amikor már több, mint kétezer év eltelt, akkor sem igazítja a mindenkori emberek felfogóképességéhez üzenetét.

    Maga a teremtett világ az ő legfontosabb bizonyságtétele. Ne felejtsd ki azonban a bűnt, ami vakká teszi az embert Isten dicsőségének meglátására.

  • Lima Rui says:

    “Egy hosszú számsor komplex információ. Egy hosszú prímszámsor komplex, specifikus információ. Előbbit irányítatlan anyagi folyamatok is tudnak produkálni, utóbbit csak intelligencia (a matematikai probabilitás miatt), ezért ha az utóbbira bukkannak, akkor intelligens okot feltételeznek a rádióhullámok mögött. Ezt tartom analógnak az életet vezérlő nagy mennyiségű komplex, specifikus információval.”
    Csakhogy a DNS, az RNS és a fehérjelánc kódja is csak egy hosszú számsor, 4 illetve 20 különféle elemmel. Nem prímszámok sorozata. Egy csillag által kisugárzott információ ennél jóval komplexebb. (Az más kérdés hogy szerinted, mint mindent, értelem tervezett. Gondolom lelkészként kreacionista vagy, nem ID-s.)

  • Szabados Ádám says:

    A DNS kódja egyáltalán nem csak egy hosszú számsor! Fehérjéket kódol. Bekapcsol és kikapcsol másolási folyamatokat. Ez funkcionálisan specifikus komplexitás. A különbség az, mint egy random számsor és egy olyan számsor közötti különbség, ami kinyit egy kombinációs lakatot. Az előbbi komplex, az utóbbi funkcionálisan specifikus is.

    Ha kreacionista alatt fiatal világegyetemben való hitet értesz, akkor nem vagyok az. Ha arra gondolsz, hogy a tudományosan is detektálható intelligens okot a Teremtő Istennel azonosítom-e, akkor az vagyok.

  • dzsaszper says:

    @brabant89:

    amit az új fajok kapcsán írsz, ott szerintem kevered a szezont a fazonnal. A biológiai fajfogalom nem feltétlen ugyanaz, mint amire a Genezis utalhat. Ld. pl. gyűrűfajok kettéesése.
    Simán tartozhat több, akár több tucat vagy párszáz faj is egy teremtett csoporthoz.
    Sem az ID sem a teremtés-tan nem zárja ki az úgymond mikroevolúciót.
    Más kérdés, hogy mi mire elég magyarázat.

    Nem értem, milyen állandó beavatkozásról beszélsz, és miért kezeled tényként az beavatkozást állandóságát, folyamatosságát.

    Az utolsó mondataid meg — ha akárcsak indirekt módon is feltételezed egy teremtő létét — kissé úgy hangoznak, mint amikor az agyag megmondja a fazekasnak, hogy mit kell csinálnia…

  • Szabados Ádám says:

    Matematikai számítások szerint tíz a hetvennegyediken az esélye annak, hogy a nukleotidok sorrendje által kódolt aminosavak egyetlen háromdimenziós funkcionális fehérjét kódoljanak. Ez borzasztóan kicsi probabilitás. Rosszabb, mintha egy tíz számjegyű lakat kombinációját szeretnéd véletlen próbálgatással megfejteni. Ennyire specifikus a DNS kódja.

  • Lima Rui says:

    Arra utaltam, hogy önmagában a DNS mint számsor nem utal intelligenciára. Pl nem prímekből áll, ilyen 4 bites rendszer spontán is keletkezhet. Ezért nem jó az analógiád a SETI által keresett jelekkel. A SETI foghat olyan jelet, ami egy 4 féle számjegyből álló sorozat és az lehet akár kód is, mint a DNS vagy egy rejtjel, de nem utal kizárólagosan értelemre, mint a prímek. A DNS-ben sem az a különleges hogy nukleotidok sorrendje, hanem hogy ez kódol valamit. Nem a jel az érdekes, hanem hogy van értelme. Egyprímszámokból álló sorozat önmagában érdekes, maga a jel jelzi az értelmet, habár megfejteni csak kvantumszámítógéppel tudnánk. (Ezért is a prímsorozat csak felkeltené a figyelmet, maga az információ csak utána jönne.) Remélem érthető a különbség. A DNS kód semmit se ér az azt értelmező polimerázok nélkül. Persze mi már értjük a polimerázok működését, valamint a riboszómákét és tRNS-ekét így számunkra is értelmezhető a kód. A vita annyi, hogy ez létrejöhet e magától vagy sem. A jelhez történő funkciórendelés a kérdés. Egy csillag rengeteg elektromágneses jelet bocsát ki magából, aminek nibcs funkciója, csak állapotjelző. De ha van a közelben egy kellően nagy hidrogénfelhő akkor beindítja a termonukleáris fúziót és létrejön egy új csillag, akár egy naprendszer. Így a jelhez rendelhetünk funkciót, bár ez a véletlenen múlik, tudattalan funkció, tervezés nélküli. Hasonlón a csillagokban jönnek létre a nehezebb elemek, de a nyomás és hőmérséklet miatt, nem azért hogy később ezekből DNS kód legyen. Ok és okozat, kérdés hogy van e cél. A kémiai molekulák a fizika és kémia törvényei alapján kötődnek egymáshoz. Ezt a vegyérték elektronhéjon található elektronok száma és az atomsugár határozza meg illetve a körülmènyek (nyomás, T, stb). Az összetett molekuláknál számít azok mérete és egyéb paraméterek, pl pólusok megléte, hozzáférhetőség, hogy egyáltalán milyen karakterű molekula fér hozzá. Ez önmagában egyfajta kódszótár, mely atomhoz atomot, molekulához molekulát rendel. Szathmáry Eörs is említi hogy molekulárisan determinált hogy melyik tRNS-hez milyen aminosav tud kötődni. Ez ugyanaz bonyolultabban hogy 2 H és 1 O a víz, de a H önmagában nem tud Ca-goz kapcsolóni. A fizika és kémia törvényei a körülményekkel és a véletlennel párosulva megalkothatja a biológiát. Szerinted az nem elég és valóban még nincs elég bizonyíték. Bár van pár. Mondjuk egy isteni entitás bevonása a képbe mindezt csak bonyolítja, ezért kell hozzá önmagában szintén nem bizonyított és bizonyítható axiómákat rendelni, pl hogy öröktől fogva létezik Ő. Pedig ez még bobyolultabb mint hogy spontán létrejöhet e élet. De ez már más téma

  • endi says:

    “A fizika és kémia törvényei a körülményekkel és a véletlennel párosulva megalkothatja a biológiát.”

    az “szent” (okkult) véletlen, mint a materializmus egyik istene… és a papjai, a diplomás “tudósok” 😀

  • Szabados Ádám says:

    Lima Rui,

    A DNS-ben sem az a különleges hogy nukleotidok sorrendje, hanem hogy ez kódol valamit. Nem a jel az érdekes, hanem hogy van értelme.

    Pontosan erről beszélek én is. Az adenin, timin, citozin és guanin molekulák önmagukban olyanok, mint a betűk vagy a számok. Komplex információ az, hogy valamilyen sorrendben elhelyezkednek ezek a számok, de ezt simán létrehozhatja irányítatlan anyagi folyamat, hacsak nincs specifikus funkciója is a számsornak. Leslie Orgel azért tett különbséget a komplex információ és a komplex, funkcionálisan specifikus információ között, mert felismerte, hogy a kristályok komplexitása és a DNS által kódolt élet komplexitása között óriási különbség van. A nukleotidok sorrendje ugyanis specifikus funkciót lát el: az aminosavak sorrendjét – és ezáltal a fehérjék háromdimenziós alakját – kódolja. Ez az, amit „nem bízhatunk” a véletlenre, mert egyetlen az élethez szükséges fehérjeszerkezet kódolásának esélye tíz a hetvennegyediken, amit a rendelkezésre álló probabilitási térben gyakorlatilag kizárhatunk mint lehetőséget.

    A kémiai molekulák a fizika és kémia törvényei alapján kötődnek egymáshoz.

    Ez tudtommal nem igaz, és állati nagy gond lenne, ha igaz lenne. Pontosan ugyanolyan kötés van minden nukleotid bázis és a cukorfoszfát képezte gerinc között, oldalirányban viszont nincs kötés a bázisok között. Bármelyik bázis ugyanolyan könnyen kapcsolódhat a gerinchez, a variációkat szinte végtelenre növelve ezzel. Éppen ez a nyitottság teszi lehetővé, hogy a DNS információt hordozzon. Ha fizikai-kémiai törvények határoznák meg a bázissorrendet, az információ eltűnne, mert redundánssá válna. Ha például az AGATCA lenne a determinált sorrend, akkor egy idő után így nézne ki az információ: AGATCAAGATCAAGATCAAGATCAAGATCAAGATCA stb. Látod a problémát? Minden információhordozó rendszer kontingens, mert ha determinált volna, akkor mindig ugyanaz ismétlődne, ami redundanciát eredményezne. Erre jött rá Dean Kenyon, pedig sokáig determinisztikus magyarázatot keresett a bázissorrendre és Biochemical Predestination c. könyvét évekig tankönyként használták. Kenyon elvetette saját elméletét, mert felismerte, hogy a nukleotidok sorrendje nem lehet determinált, mert akkor nem hordozhatna információt. Ugyanezt hangsúlyozza Polányi ‘Life’s Irreducible Structures’ c. esszéjében is. És ezért nem működik Prigonine és Nicoli determinisztikus elmélete sem.

    A fizika és a kémia törvényei a véletlennel párosulva sem képesek nagy mennyiségű komplex, funkcionális információt előállítani. Ezért jó tudományos program a SETI programja, és ezért jó tudományos program az ID programja is. Mindkettő azt feltételezi, hogy az intelligens ok bizonyos filterekkel kiszűrhető, detektálható. Amikor nagy mennyiségű funkcióspecifikus információval találkozunk, normális esetben nem véletlenre és szükségszerűségre, hanem intelligenciára következtetünk. Mert tudjuk, hogy mire képes az előbbi, és tudjuk, mire képes az utóbbi. Nagy mennyiségű komplexitásra képes a véletlen. Nagy mennyiségű funkcióspecifikus komplexitásra nem, maximum akkor, ha a probabilitási tér (a rendelkezésre álló próbálkozások száma) határtalan. De hát tudjuk, hogy nem az.

  • dzsaszper says:

    Kedves Lima Rui,

    a DNS esetében az utal intelligenciára, hogy ez egy nyelv, és van rá fordítóprogram. A te sejtjeidben is 🙂

    Egy szemantikával rendelkező nyelv intelligenciát feltételez 🙂

  • Szabados Ádám says:

    Lima Rui,

    itt egy részletes kritika M. Yarus Direct RNA Templating (DRT) modelljéről, amely az általad is említett kémiai affinitást feltételezi az RNS-ek és az aminosavak között, hogy ezáltal a DNS kódszekvencia eredetét megmagyarázza.

  • ILLED says:

    Nekem úgy tűnik, hogy Szabados Ádám és Lima Rui vitája elveszett a részletekben.

    Nem arról van egyszerűen csak szó, hogy Szabados Ádám szerint
    A) elhanyagolhatóan kicsi a valószínűsége, hogy prím számok jönnek létre véletlenül;
    B) elhanyagolhatóan kicsi a valószínűsége, hogy a DNS-ek véletlenül jöjjenek létre.

    Mégis, a fősodorbeli tudomány A) esetben intelligenciára következtet, míg B) esetben véletlenre.

    Az, hogy mi miatt elhanyagolható a valószínűség (prím számsor vagy specifikus komplexitás), lényegtelen, így ennek fejtegetése is lényegtelen. Rosszul látom?

    Szabados Ádám:
    „Nagy mennyiségű funkcióspecifikus komplexitásra nem, maximum akkor, ha a probabilitási tér (a rendelkezésre álló próbálkozások száma) határtalan. De hát tudjuk, hogy nem az.”

    Honnan tudjuk?

  • Szabados Ádám says:

    ILLED,

    onnan tudjuk, hogy nem határtalan a probabilitási tér, hogy a Föld kb. 4,5 milliárd éves, az élet pedig legalább 3,5 milliárd éves, a próbálkozási lehetőségek a kettő közé esnek.

  • ILLED says:

    Szabados Ádám:

    De erre mondhatjuk azt is, hogy elképzelhető, hogy a mindenség végtelen, és van benne végtelen olyan Föld is, amelyen nem alakult ki az élet, nem?

  • Szabados Ádám says:

    Jelen tudásunk szerint az univerzum nem végtelen. Az általunk ismert élet az általunk ismert univerzumban behatárolt probabilitási térben alakulhatott csak ki. Ha a multiverzum hipotézissal akarja valaki alátámasztani az élet véletlenszerű kialakulásának esélyét (tehát hogy végtelen számú univerzum létezett, ezért valahol egyszer ki kellett alakulnia az életnek), és ezt elfogadjuk érvként, onnantól bármit – a legvalószínűtlenebb eseményt is – alá lehetne ezzel támasztani. Azt is, hogy az életed egyszer már pontosan így lejátszódott egy pontosan ugyanilyen univerzumban. Ez azonban nagyon messzire vezetne a valódi tudománytól…

  • ILLED says:

    Köszönöm az eddigi gyors válaszokat!

    Descartes-i módon vethető el, mert ha már ezt feltesszük, akkor bármit feltehetünk, akár azt is, hogy bolondok vagyunk, vagy hogy van egy Genius malignus? Vagy Occam borotvája vágja le, mint fölösleges axiómát? Tényleg érdekel, mert én nem tudom elvetni. Miért vezet messzire a valódi tudománytól?

  • Szabados Ádám says:

    Azért vezet messzire a valódi tudománytól, mert

    1) a multiverzum-elméletnek nincs semmiféle empirikus alapja, hipotetikus feltevés csupán, hiszen az egyetlen univerzum, amelyet ismerünk és amelyről tapasztalatunk van, a mi univerzumunk;

    2) ha a végtelen számú univerzum hipotézisét használjuk egy rendkívül valószínűtlen esemény lehetőségének igazolására, akkor gyakorlatilag bármilyen eseményt igazolhatunk ezzel, a legvalószínűtlenebbet is, és ez az ésszerű magyarázatok és a racionális érvelés végét jelentené,

    3) Occam borotvája valóban levágja ezt az érvelést, hiszen a Teremtő létezése kevesebb ismeretlent tételez és sokkal egyszerűbb magyarázat a végtelen számú univerzumok hipotézisénél.

  • Lima Rui says:

    A Teremtő mindenható, bármire és mindenre képes, így legalább annyi ismeretlent tartalmaz mint a multiverzum. Occam borotvája őt is levágja.

  • Szabados Ádám says:

    Egynek veszel két problémát. Az egyik probléma a multiverzum elmélettel az, hogy ha a matematikai valószínűtlenséget a segítségével akarjuk megoldani, akkor lényegében megszűnik minden valószínűtlenséggel kapcsolatos probléma, és az ég világon minden lehetségessé válik, beleértve azt is, hogy amit most átélünk, egy az egyben lejátszódott már egyszer. Tudományos szempontból ez enyhén szólva aggályos. A másik probléma a multiverzum elmélettel Occam borotvája, az a filozófiai elv, hogy egy jelenség magyarázatai közül az egyszerűbbet kell választani, kizárva a felesleges hipotéziseket. Te a kettőt egynek vetted.

    Occam borotvája nem a Teremtő mindenhatóságával foglalkozik, hanem a Teremtő hipotézis és a multiverzum hipotézis közül választja ki az egyszerűbbet. Ebben az esetben az egyszerűbb hipotézis a Teremtő hipotézise, mert több dolgot kell feltételezni a multiverzum elmélethez, mint a Teremtő létezéséhez. Occam elvét persze nem kell készpénznek vennünk, szerintem bizonyos esetekben félrevezető, csak azért említettem, mert naturalista elméletek hívei előszeretettel használják, viszont ebben az esetben a borotva éppen róluk szedi le a felesleges szőrzetet.

  • Lima Rui says:

    Az Everett-féle multiverzum teória egy szép megoldás pár kvantumfizikai problémára. Ki is terjesztem az evolúcióra (biztos már megtették mások is): mivel a multiverzum hullámfüggvénye akkor omlik össze egy realitásba, ha van értelmes megfigyelő, így a végtelen sok párhuzamos Földön végtelen eshetőség megtörténhet, de értelmes élet és megfigyelő csak ott alakulhat ki, ahol az evolúció elindulhatott egyáltalán. Így ha az evolúció kialakulásának esélye végtelenül kicsi is, de matematikailag létezik, akkor a végtelen lehetőség közt szükségszerűen kialakul az értelmes élet (ember), így a hullámfüggvény összeomlik az egyik olyan univerzumbaa, ahol először kialakult és az evolúció tényleges realitássá válik.
    Persze nem állítom, hogy ez így lenne, ez kívül van a mi univerzumunk oksági mezején. De a Teremtő miért lenne ennél valószínűbb hipotézis? Egy intelligencia, ami öröktől fogva volt és van? Hogyan? Miből áll? Miért? Miért több, mint puszta anyag és energia? Miért teremtette a világot? Az életet? Az embert? Persze én sem tudom kizárni egy Isten létét, hisz hasonlóan a multiverzumhoz, ő is kívül van a megismerhetőségünkön. Mármint egy olyan isten, amelyik létezhet, hisz ha van is, biztos nem olyan mint a keresztény Isten vagy bármely más vallásé. Persze ha mindenható, akkor egyben olyan is, mint a keresztény Isten, hisz mindenhatóként mindenre képes. Akár teremthet multiverzumot, mindegyikben más fizikai törvényekkel. Visszatekerheti az időt, átírhatja a valóságot. Ez a 2 pont önmagában több, mint amire a fizikusok multiverzuma képes. Isten bármit megtehet, amit akar.
    És amúgy nem vettem a kettőt egynek. Ahogy előzőleg leírtam, ha ez a 2 teória versengene egymással, akkor is Istenben sokkal több a változó, sokkal több a felesleges sallang, mint a multiverzum elméletben, melyre akár utalhatnak tények is, pl a kétréses kísérlet és utódai. A Teremtőre ugyanannyi tény utal, mint Zeuszra vagy Visnura vagy Gandalfra, bár ez utóbbiban talán senki sem hisz. De nem csak ez a 2 teória verseng egymással, illetve az evolúciós elméletnek nem kell megmagyaráznia az univerzum eredetét. Ismert, megfigyelhető tény, hogy más naprendszerekben, csillagfelhőkben vannak szerves molekulák, vagy prekurzoraik: metán, HCN, etanol, glikolaldehid, formaldehid, HCOOH. Mostanában találtak glicint egy üstökösön, ami egy fehérjealkotó aminosav.A Földön is abiotikus úton létrejöhet és létrejöhetett ribóz, deoxiribóz, a nukleotid bázisok és az aminosavak is. Az ősi Földre záporoztak a meteoritok, rengeteg szerves és szervetlen molekulát hozva. Hatalmas villámok, energiakisülések voltak. Volt víz és agyag közegnek, fémkelátok reakciók gyorsításához. Rövid DNS és RNS láncok létrejöhetnek spontán és még replikációra is képesek tisztán kémiai alapon, bázispárosodás útján. Foszfolipid membránok zárhatnak be vizes közeget, benne szerves vegyületekkel. Ismertek koacervátumok maradványai. Persze mindenezek önmagukban nem elegek az élethez, a kulcslépés még mindig hiányzik, de a kirakós nagy része meg van. Isten létéhez csak pár puzzle darab van csak: egy ősi könyv, melyet emberek írtak. Egy vallás, melynek törvényeit emberek alkották. És több milliárd ember szubjektív hite. Occam borotvájának könnyű dolga van.

  • Lima Rui says:

    Hasonlóan az ID-vel szemben. Ha a Földön nem jöhetett létre spontán az élet és nem evolválódhatott intelligens szintre, akkor máshol hogy tehette? Ahol max pár körülmény más, de ugyanazok a fizikai törvények és a kémiai elemek. És ha létre is jött élet, az rögtön értelmes lett? Igazából az ID is Istennel magyaráz, csak erre se jöttek rá, ezért nem is keresik, hogy ki a Teremtő.

  • Lima Rui says:

    Nem voltam teljesen világos. Az ID-nél úgy értettem, hogy máshol hogy alakulhatott ki élet és fejlődhetett olyan magas szintre, azaz lett belőle a Tervező, hogyha mindez nem történhetett meg a Földön és nincs evolúció. Mégis milyen molekulákkal, vegyületekkel gondolják ezt, ami rögtön ilyen intelligens lett? Sötét anyag talán, mert arról úgysem tudunk semmit? Vagy egy más univerzumból jött entitásról van szó?
    Mellesleg a vallásosak honnan tudják, hogy van Isten? Vagy hogy akit ők annak hisznek az tényleg Isten? Hogy tényleg ő teremtett mindent? Mert azt mondja? Mert azt érzik? Mert azt hiszik? És ha csak egy huncut űrmanó sugdos a fülükbe 2000 éve? (Más vallásnál persze régebb óta.) Vagy csak az agyuk találja ki az egészet?
    Ejj. Egy irracionális agytól miért várok racionális gondolkodást?

  • dzsaszper says:

    Kedves Lima Rui,

    >>> Igazából az ID is Istennel magyaráz,
    Ez nem igaz, az ID-be akár a Crick-féle irányított pánspermia elméletig elég sok minden belefér.

    Az ID-nek nincs szüksége Istennel operálásra: az abiogenezist cáfolja, mint indirekt feltevést 🙂

  • Szabados Ádám says:

    Lima Rui,

    jó sok dolog keveredik a hozzászólásodban: tudományos tények, tudományos hipotézisek, áltudományos propaganda, és kissé ügyetlen teológiai okfejtés. Nem fogok mindenre válaszolni, csak azokra, amik relevánsak a cikk témája szempontjából.

    1. A kémiai evolúció (abiogenezis) olyannyira valószínűtlen, hogy Wigner Jenő Nobel-díjas fizikusunk szerint egyenesen lehetetlen. Az, hogy aminosav létre tudott jönni, körülbelül olyan távol van még mindig az első élettől, mint a szuperszonikus repülőgép véletlen létrejöttéhez az, hogy a repülőgép botkormányához szükséges anyag egyik komponense valahogy valahol véletlenül összeállt.

    2. A multiverzum-elmélet olyat feltételez, amiről nincs semmilyen empirikus ismeretünk. Ezzel szemben azt tapasztalatból tudjuk, hogy nagy mennyiségű funkcióspecifikus információt és általa vezérelt rendszereket intelligencia hoz létre, és csak intelligencia hoz létre, anyagi folyamatok nem. A Teremtő feltételezése ebből a tapasztalatunkból származik (valamint teisták szerint számos egyéb tapasztalatunkból is, amit ateisták nyilván nem fogadnak el érvnek, teistáknak viszont nagyon is valóságos érv). A multiverzum-elmélet sokkal több ismeretlen hipotézist tesz szükségessé, mint a tapasztalatunkból ismert Tervező-hipotézis, hiszen ahogy John Polkinghorne Cambridge-i elméleti fizikus is mondta: a multiverzum-elmélet meglehetősen gazdaságtalan elmélet. Ezért borotválja le Occam borotvája.

    (“The multiverse option is a very extravagant suggestion. It postulates the existence of all these trillions and trillions of universes, all unobservable by us, all different in their characters and so very different that, by chance, one of them turns out to be OK for carbon based life. Now that’s a very bold speculation and it’s certainly not a scientific theory. It’s a metaphysical guess as we might say. It goes beyond physics into some sort of philosophy. As, of course, does the idea that the universe is a creation in the same sort of way. But I think that the multiverse is first of all a very uneconomic assumption to make.” – Polkinghorne)

    3. A cikkben nem volt szó arról, hogy szerintem máshol magától létrejött volna élet az univerzumban, sem arról, hogy lenne egyáltalán máshol élet. Nagyon valószínűtlennek tartom, hogy a SETI programjai valaha földönkívüli életre bukkannak. Ha azonban ez megtörténne, akkor sem gondolom, hogy az ottani élet magától jött volna létre, mert ezt matematikai valószínűség alapján kizárhatónak tartom. Viszont a cikk arról szólt, hogy a tudomány, ami a SETI programjai mögött van, azt gondolja, hogy bizonyos szűrők alapján detektálni tudunk intelligens okra utaló jeleket. És maga ez a feltételezés az, amit érdekesnek tartok, mert az élet rendszereiben található jelek pontosan ugyanazon szűrők alapján mutatnak intelligens ok irányába, amelyeket a SETI is alkalmaz.

    4. Hogy a vallások honnan tudják, hogy van Isten? Ez nem a cikk témája, de sok dolgot lehetne válaszolni a kérdésedre. Először is nincsen olyan, hogy a vallások. Másodszor, Isten létezése szerintem sokkal alapvetőbb, intuitívebb és racionálisabb feltételezés, mint ennek az ellenkezője, nem véletlen, hogy az ateizmus mindig egy elenyésző kisebbség világnézete volt, és ma is így van. Talán a nyugati egyetemek az egyetlen hely, ahol az arány valamicskét az ateizmus felé billen, de ott sincsenek sokkal többen, mint a teisták. (Mondhatod persze, hogy lám, az okos emberek nagy része ateista, ez azonban helytelen következtetés lenne annak fényében, hogy számos Nobel-díjas tudós éppen a tudomány miatt fordított hátat az anyagelvű világképnek.)

    Isten létezésére szerintem rengeteg dolog mutat. A természetben a világegyetem finomhangoltságától kezdve az élet csodálatos rendszerein át a morális törvény létéig megszámlálhatatlan bizonyíték. Maga az öntudattal bíró ember, a művészet, a lelkiismeret, és a sensus divinitatis, ami minden emberben ott van (azokban is, akik elnyomják azt és érveket keresnek, hogy tagadhassák): mind a Teremtő létezése irányába mutat. Isten létezését onnan is tudjuk, hogy a történelemben sokszor kinyilatkoztatta magát. Sokunk meggyőződése például, hogy Jézus Krisztus feltámadt a halálból. A végére hagytam a személyes tapasztalatot, azt, amikor egyszer csak ott vagy lélekben Isten előtt, és tudod, hogy a jelenléte körbefon téged, hogy nem tudsz sehová menni előle, mert ő mindenütt jelen van, leginkább ott, ahol vagy, te pedig lemeztelenedve állsz és nem tudsz sehová elrejtőzni. És csak azt kéred, hogy bocsásson meg és hogy maradhass a közelében, mert végre hazaértél.

  • Lima Rui says:

    dzsaszper
    Ha az ID szerint nincs abiogenezis, akkor hogy keletkezett az élet ott, ahonnét a Földre került? Vagy ha ez egy láncolat, akkor hogyan keletkezett először? Erről mit mond az ID?
    Szabados Ádám
    2. Írtad valahol, hogy úgy hiszed egyedül vagyunk az Univerzumban. Mire fel akkor a 1022 csillag, legalább ennyi bolygóval? Ez is elég gazdaságtalan. Amúgy egy mindenható Istennél bármi megtörténhet, ok és okozat elveszti a kapcsolatát, hisz bármi lehetséges. Istennel lehet a multiverzumot is magyarázni, ha épp az kell, akkor Isten egy gondolatával teremthet végtelen számú világot. De amúgy a multiverzm hipotézist te hoztad szóba. Nem csak Isten és a multiverzum verseng egymással. Valójában a releváns amerikai tudósok 94,4%-a elfogadja, hogy fél milliárd év után egy bolygónyi méretű lombikban összejöhet az élet. Lehet, hogy nincs mellette elég bizonyíték, de cáfolat még kevesebb van. Viszont maga Isten léte körül annyi a bizonytalanság, hogy jött létre? mikortól van? mi ő? honnan veszed azt, hogy tényleg az aminek hiszed? stb, sorolhatnám napestig, ráadásul 1 csepp bizonyíték sincs mellette. Az abiogenezis mellett legalább érvel az, hogy a makromolekulák spontán létrejöhetnek. Isten mellett ennyi sincs. Occam borotvája lazán lenyisszantja, nem hiába érvelnek ezzel az ateisták, de valahogy neked nem jött át a gondolatmenet.
    Amúgy aki a közös leszármazást vitatja az szándékosan vak és süket. Attól még lehetne tervezett, de aki tervezte és megalkotta az mindig a már meglévő alakokból tette, ami logikus módszer.
    4. A világegyetem finomhangoltságáról annyit, hogy ez a probléma eleve csak egy olyan világegyetemben merülhet fel, amelyiknek a paraméterei alkalmasak intelligens élet megjelenésére. Szerinted a finomhangoltság az értelmes tervezés bizonyítéka. Szerintem az értelmes élet a finomhangoltság bizonyítéka.
    Morális törvény? Az mi lenne?
    Az öntudattal bíró ember miért van kívül az élet csodáin? Miért külön pont?
    “Sokunk meggyőződése például, hogy Jézus Krisztus feltámadt a halálból.” Az utolsó tagmondat bármire kicserélhető, pl: “hogy van evolúció”, “hogy a Szíriuszon karfiolemberek élnek”, stb.
    Amit ezután írsz, azt inkább ne firtassuk.

  • Szabados Ádám says:

    Lima Rui,

    Isten nem jött létre. Kategóriahiba a teremtetlennek gondolt létező kapcsán azt kérdezni, hogy hogyan jött létre. Isten nem jött létre, hanem van, ezért nem teremtmény, hanem Teremtő. Dawkins, aki népszerűsítette az általad felvetett dilemmát, elképesztően rossz filozófus. A teista kiindulópont lényege az, hogy Isten mindig volt, csak az univerzum keletkezett. Annak van kezdete és oka, ami keletkezett.

    Az, hogy mit gondolnak tudósok arról, hogy összejöhet-e az élet egymilliárd év alatt egy lombikban, nem változtat azon a tényen, hogy senkinek sincs fogalma arról, hogy ez mégis hogy történhetett. Azért gondolják tudósok közül sokan, hogy az élet magától létrejött, mert azt feltételezik, hogy naturalista folyamatoknak kell az élet létezését magyarázniuk, magyarán ha létezik, létre kellett tudnia jönni magától. Akkor is, ha elképzelésünk sincs arról, hogy hogyan, és akkor is, ha ez matematikailag egyáltalán nem tűnik lehetségesnek. Én nem vagyok naturalista, ezért nem hiszem, hogy a kozmosz és az élet magyarázata magában a kozmoszban rejlik. (Ezzel a véleményemmel nem vagyok egyébként rossz társaságban.)

    Isten létezése mellett sokkal több bizonyíték van, mint a mellett a hipotézis mellett, hogy az információ-vezérelt élet magától jött létre (véletlen és szükségszerűség által). Ez a jelenségek természetéből következik. Ha a szobámban az asztalon holnap találok egy tál süteményt, tudni fogom, hogy azt valaki elkészítette és odatette. Ha üvegdarabokat fogok ott találni egy kitört ablak mellett, azt fogom valószínűsíteni, hogy nyitva hagytam az ablakot és a szél becsapta. A hipotézisem a jelenség természetétől függ függeni, nem attól, hogy mit tudok az intelligenciáról, amit intelligens ok esetében feltételezek. A Teremtő létezésére a teremtés milyensége a bizonyíték, akkor is, ha a Teremtőről más forrásból semmit sem tudnánk.

    Nekem az furcsa, ha valaki a világegyetem finomhangoltsága kapcsán nem veszi észre a nyilvánvalót, hogy ez nem lehet véletlen. (Esetleg nézd meg ezt vagy ezt.) A tény, hogy van élet, ugyanúgy nem magyarázat az univerzum finomhangoltságára, mint az asztalomon lévő sütemény arra, hogy miért van. W. L. Craig filozófustól hallottam a következő illusztrációt. Tegyük fel, hogy valaki egy száz tagból álló kivégzőosztag előtt áll bekötött szemmel. Amikor a lövések eldördülnek, azt tapasztalja, hogy életben maradt. Három magyarázat lehet erre: véletlen, szükségszerűség, vagy szándék. A szükségszerűséget ki lehet zárni, mert egyáltalán nem szükségszerű, hogy száz emberből egy se találjon el. A véletlen ebben az esetben szintén kizárható, mert egy-két ember még elhibázhatja a lövést, de száz nem fogja elhibázni. Marad az a magyarázat, hogy valakinek az volt a szándéka, hogy minden lövés félremenjen. (Ez ugye megtörténik a való életben.) Az univerzum finomhangoltsága esetében ugyanez a három lehetőség van. Az életet megszámlálhatatlan tényező veszélyezteti, mégis van. Azért, mert ez szükségszerű? Nem, hiszen sehol máshol nem találkoztunk még élettel, és teljesen elképzelhető, hogy a mi Földünkön se legyen élet. Véletlenül van? Kizárt, ennek az esélye matematikailag annyira kicsi, hogy elhanyagolható. Az egyetlen ésszerű magyarázat az, hogy ezt valaki így alkotta meg. Az ateista Fred Hoyle mondta, amikor az univerzum finomhangoltságának ténye elkezdett nyilvánvalóvá válni: „Valami Intelligencia meg kellett hogy babrálja a fizikai törvényeit!” Máshogy ez számomra elképzelhetetlen.

    Morális törvény alatt ilyesmire gondoltam. Arra a tényre, hogy bizonyos dolgokat jónak (helyesnek), más dolgokat rossznak (helytelennek) tartunk (még ha nem is mindig értünk egyet abban, hogy egyik vagy másik kategória pontosan mit is takar). Naturalista univerzumban csak a van van, a kell nincs, ha mégis beszélünk kellről, az azt jelenti, hogy nem csak az van, ami van, vagyis van más is a természeten kívül. A morális törvény törvényadóra mutat. Még a klasszikus istenérveket darabokra szedő Kant is hangsúlyozta, hogy erkölcsi törvény csak akkor létezik, ha Isten létezését feltételezzük. Egyébként csak az van, ami van, nincs olyan, hogy valaminek lennie kell.

    Az öntudattal kapcsolatban ajánlom ezt a Freund Tamás agykutatóval készült interjút.

  • dzsaszper says:

    Kedves Lima Rui,

    rátapintottál a lényegre: az ID annyit mond, hogy ez egy láncolat, és volt valamilyen előző láncszem. Ennél pontosabban annyit mond, hogy volt már intelligencia a földi élet előtt. Mint mondtam, erre a következtetésre indirekt érveléssel jut. Itt meg is áll, mert tiszteli a természettudomány hatáskörének határait.
    Ne keverjük a természettudományt a science fictonnel! Örülnék, ha ebben meg lehetne állapodni a neodarwinistákkal is 🙂

    Catlakakozom Ádám filozófiai észrevételéhez a kategóriashibával kapcsolatban.

  • Lima Rui says:

    “Isten nem jött létre.” Tisztában vagyok vele, hogy a hívők így gondolják. De erre mi a utal a hitükön vagy a Biblián kívül? Mert állítja? Mert érzitek?
    “Isten nem jött létre, hanem van, ezért nem teremtmény, hanem Teremtő. ”
    Logikailag az utolsó tagmondat nem következik az előzőekből.
    Persze értem én, hogy míg az evolúció tudományos elmélet, ezért tudományos érvekkel kell támadni, addig a hit az irracionális, így rá a tudományos érvek nem kellenek, hogy vonatkozzanak. Bár éppenséggel vonatkozhatna, illetve miért nem vonatkozik? Bármit amit fel lehet hozni Isten mellett az csak filozófiai érvelés, nem bizonyíték. A morális törvényed, a jó és a rossz, teljesen emberi fogalmak. Persze az egész Isten-hit ember-centrikus, így az érvrendszere nyilvánvalóan is az.
    Az ID és különböző hitek ugyanazzal a problémával néznek szembe. És a tudomány is. (Illetve több is a probléma, de van egy alap, egy fókuszpont). És ez a kezdetek, a teremtés, teremtettség, a kialakulás, ki minek gondolja. Az ID erre nem válaszol, “Itt meg is áll, mert tiszteli a természettudomány hatáskörének határait.” Ha megpróbálna válaszolni, akkor azzal kéne szembesülnie, hogy túl kell lépnie a természettudomány hatáskörén és átlépnie a metafizikába, és feltételeznie kéne már egy intelligenciát az Univerzumunk törvényein kívül vagy előtt. Ezt, illetve Őt, a hívők Istennek hívják. Ezzel az ID (helyesen) nem foglalkozik, mert ez tényleg túl van a megismerhetőségenk. A hívők viszont igazolni próbálják az igazolhatatlant, racionális érvekkel bizonyítani az irracionálist. Az a hívő jobban teszi aki egyszerűen csak hisz, bár az embereket foglalkoztatják ezek a kérdések.
    A tudomány válaszolni próbál. Mivel a megismerhetősgének vannak határai, nem lehet mindenre választ adni. A Föld távoli múltja önmagában egy hatalmas korlát, ezért itt elméletekre kell támaszkodni, amik nem mindig elég erősek. Valaki mondta, sajnos nem emlékszem már rá, hogy ki, de a lényeg az én szavaimmal, hogy mivel semmi bizonyíték nincs Isten (és ezt behelyettesíthetjük az ID X-ével is) mellett, eleve a léte olyan kérdés amivel a tudomány nem tud mit kezdeni, ezért bármilyen valószínűtlen is, az abiogenezis marad. Vagy genezis volt, vagy abiogenezis, más nincs. És mivel az előbbi még valószínűtlenebb, hisz az egyenletnek van egy olyan ismeretlene, ami eleve mérhetetlenül komplexebb, mint bármi, amit tapasztalhatunk vagy egyáltalán elképzelhetünk, ezért marad az utóbbi. Persze ez sem tudományos érv. Azon dolgoznak még.

  • dzsaszper says:

    Kedves Lima Rui,
    “Isten nem jött létre.” Tisztában vagyok vele, hogy a hívők így gondolják. […]

    Itt ‘lljunk meg egy kicsit. A dolog elsősorban nem hívőkről ill nem hívőkről szól. Elég kurtán-furtán intézel el egy néhányszáz éves filozófiai, ontológiai vitát. Aquinói Tamás (hoppá), David Hume, Immanuel Kant ellenvetéseivel is sokkal inkább lehet érdemben vitázni, egy halom dologban igazat is tudok adni nekik…

    “Persze értem én, hogy míg az evolúció tudományos elmélet”
    Rosszul érted. Az evolúció reszben valóban tudományos elmélet, de elsősorban a neodarwinisták értelmezésében több ennél, és leginkább a vallás jeleit mutatja, aminek szüksége van egy vallásos teremtésmítoszra, Véletlen istenség vezetésével. Ide leginkább az abiogenezis és a kezdeti filogenezis tartozik.

    Egy-két extrém kivételtől eltekintve nem láttam hívőt, aki tudományos módon akarta volna igazolni a (tudományosan) igazolhatatlant. A neodarwinizmus mint vallás oldaláról ezt sokkal inkább látom.

    “mivel semmi bizonyíték nincs Isten (és ezt behelyettesíthetjük az ID X-ével is) mellett, eleve a léte olyan kérdés amivel a tudomány nem tud mit kezdeni, ezért bármilyen valószínűtlen is, az abiogenezis marad. Vagy genezis volt, vagy abiogenezis, más nincs. És mivel az előbbi még valószínűtlenebb, hisz az egyenletnek van egy olyan ismeretlene, ami eleve mérhetetlenül komplexebb, mint bármi, amit tapasztalhatunk vagy egyáltalán elképzelhetünk, ezért marad az utóbbi.”

    Na megint álljunk meg egy pillanatra megint.

    Egyrészt. az ID indirekt érvelésével — tegyük föl, hogy nem volt intelligencia, ellentmondásra jutunk — tud a tudomány mit kezdeni. Ez az érvrendsyer épp az abiogenezist igyekszik cáfolni.

    Másrészt, mivel valószínűtlen Isten léte, ezért felruházzuk a véletlent isten erővel és csinálunk belőle Véletlen Istenét. Tehát itt nem létező Isten vs. nincs Isten, hanem egyik Isten vs. másik Isten a vita témája.

  • Szabados Ádám says:

    Lima Rui,

    nem arról van szó, hogy az Istenbe vetett hit irracionális lenne (egyáltalán nem az), hanem arról, hogy a „Ki teremtette Istent?” típusú dawkinsi érv, amit itt te is megismételtél, rossz érv. Abból indul ki, hogy minden keletkezett, és aztán a keletkezett dolgok oksági elvéből Isten létezésére kérdez rá. Ez hibás logika. A teista alapállás keletkezés nélküli Teremtő létezését tételezi, ezért vele kapcsolatban hibás a keletkezésre rákérdezni, mert a keletkezés nélküli Isten lényegét tekintve nem keletkezett entitás. Ez egy metafizikai alapállás, ugyanolyan hit alapú kiindulópont, mint az a metafizikai alapállás, hogy minden a semmiből keletkezett, vagy az a metafizikai alapállás, hogy az anyag vagy az energia öröktől fogva létezik.

    A tudomány a jelenségek világát kutatja, más szóval a természetet. A metafizika a természeten túliról gondolkodik. A tudomány a természet vizsgálata által tud okokra következtetni. Intelligens okokra is (pl. Húsvét-sziget szobrai, ókori feliratok, épületek, romok, barlangrajzok). A tudomány akkor is tud intelligens okokra következtetni, ha nem tud semmit mondani az intelligens alkotóról. A vallás nem a tudomány módszereivel keresi a megismerést, de ettől a vallás még nem irracionális, és nem is tudománytalan. Ahogy a tudomány csúcsain általában ezt jól látták: a tudomány és a vallás (illetve a valóság megismerésének más útjai) komplementer viszonyban vannak egymással. Sőt: a tudomány a keresztény hitből nőtt ki és ma is monoteista előfeltevései vannak. (Itt, Cambridge-ben, ahol éppen vagyok, rengeteg nyoma van ma is a modern tudomány keresztény gyökereinek.)

    Az abiogenezis viszont engem az alkímiára és a perpetuum mobile megalkotására emlékeztet. Nagy mennyiségű, komplex, funkcionálisan specifikus információt irányítatlan anyagi folyamatok nem hoznak létre. Egyetértek Wigner Jenővel: „a kémiai evolúció lehetetlen”.

    A moralitás eredetét nem lehet olyan könnyen elintézni, ahogy teszed. Ajánlom még egyszer ezt a cikket.

  • Lima Rui says:

    Lehet, hogy nem voltam világos (sőt, biztos). A „Ki teremtette Istent?” kérdésre a keresztények és sok más ember válasza az, hogy „A teista alapállás keletkezés nélküli Teremtő létezését tételezi”. De vannak egyéb hitrendszerek is, ahol istenek születnek, teremtődnek vagy teremtettnek, így a kérdés jogos, habár előre tudtam a válaszodat rá, így egyben felesleges is volt. Engem inkább az érdekel, hogy honnan tudod ezt a választ? Hasonló kérdés, hogy honnan tudod vagy véled tudni, hogy a te hited az igaz? Vagy mindegyik igaz? Bizonyára az sem véletlen, hogy egy ember hite függ a neveltetésétől és a kulturális környezetétől. Te se lettél buddhista. Feltételezem a szüleid is keresztények.
    „Ez egy metafizikai alapállás, ugyanolyan hit alapú kiindulópont, mint az a metafizikai alapállás, hogy minden a semmiből keletkezett, vagy az a metafizikai alapállás, hogy az anyag vagy az energia öröktől fogva létezik.” Ez igaz, a megismerésnek vannak határai. De az tény, hogy anyag van, akárcsak az, hogy élet is van (persze, lehet ezeket is vitatni, de az már abszolút filozófia). Isten léte nem tény, csak sokan hisznek sokféle istenben, meg sokminden másban is, bármiben, így a Teremtéshez be kell vonni az egyenletbe egy ismeretlent. Amely ráadásul mindenható, így vele bármi megmagyarázható. Miközben a mindenhatósága (persze ha létezik) szintén túl van a megismerhetőségnek. Akárcsak az, hogy mindig is volt. Az is lehetne, hogy Isten maga az Univerzum és együtt robbantak ki a szingularitásból. Lehet, hogy ő teremtette az életet, de az ő megismerhetőségén is kívül van az, hogy ő hogyan teremtődött. A mi koordináta rendszerünkben mindenható, akár mondhatja is az egyszerű rézkori embereknek ezt, de attól még nem feltétlenül az.
    Amúgy értem én, hogy a blogod nem erről szól, de itt legalább meg lehet vitatni ezeket a kérdéseket, vagy legalábbis felvetni.
    dzsaszper
    „Másrészt, mivel valószínűtlen Isten léte, ezért felruházzuk a véletlent isten erővel és csinálunk belőle Véletlen Istenét.”
    Talán nincs véletlen? Nyerni az ötös lottón nem véletlen? Persze, lehet azon filozofálni, hogy mi a véletlen, de talán ezt lehet hívni annak. Mint ahogy azt is lehet hívni véletlennek, hogy mondjuk egy 5 aminosavat hordozó meteor becsapódik egy olyan tengerbe, ami már tartalmaz koacervátumokat meg egy csomó trutyit, ami kellhet az élethez. De ez nem feltétlenül véletlen, hisz meteorok és üstökösök tízezrei csapódtak a fiatal Földbe, lehet hogy mind hordozott szerves molekulákat. Ezt pl lehet véletlennek hívni, de lehet hogy ez általános az Univerzumban. Lehet rá mondani, hogy a körülmények összejátszása. Vagy hopgy a nagy számok törvénye alapján. Ha veszel 45 millió szelvényt akkor biztos hogy nyersz a lottón, de hogy melyik szelvényt húzzák ki, melyik számokat, az véletlen.

  • Szabados Ádám says:

    Lima Rui,

    a zsidó-keresztény monoteizmust az különbözteti meg az ősi mítoszok teogóniáitól és a modernkori naturalizmustól, hogy nem a kozmosz létét tekinti kiindulópontnak, hanem Isten létét. Tehát nem azt feltételezi, hogy a kozmosz hozta létre az isteneket (vagy azok ideáit), hanem azt, hogy Isten hozta létre a kozmoszt. („Kezdetben teremtette Isten az eget és a földet.”)

    Ez ún. „első filozófia”, amit a teista gondolkodás ugyanúgy kiindulópontnak használ, mint a materialista gondolkodás a maga „első filozófiáját”, az anyagelvűséget. Gödel bebizonyította, hogy minden logikai rendszerben van olyan állítás, amit a logikai rendszeren belül nem tudunk igazolni. A naturalizmus metafizikai kiindulópontja az, hogy végső soron mindent a fizika személytelen törvényei határoznak meg. Ez azonban ugyanúgy nem bizonyított állítás, mint az, hogy a végső valóság valamiféle Elme.

    Ez nem azt jelenti, hogy nem lehetnek jó érvek egyik vagy másik metafizikai kiindulópont mellett. A naturalizmus melletti érv az, hogy a természetet (anyagot, energiát) látjuk, érzékeljük, mást viszont nem, ezért az a legbiztosabb, ha a valóság értelmezésének kiindulópontjaként is a kozmosz valóságát fogadjuk el. Az anyag és a kozmosz vizsgálata azonban sok gondolkodót vezetett arra a következtetésre, hogy az anyag nem lehet a végső valóság, valamilyen Elmének lennie kell az anyag mögött. (Ajánlom ezt a sorozatot, ahol számos Nobel-díjas tudós mondja el ezt a meglátását.) A 20. század egyik nagy felfedezése, hogy az univerzum elképesztő módon finomhangolt az élet számára, antropikus elv jellemzi, másik nagy felfedezése pedig az, amit csak most kezdünk igazán megérteni, hogy az élet folyamatait rendkívül összetett, epigenetikai szinteken is jelenlévő információ vezérli. Vagyis a végső valóság nem is az anyag és az energia, hanem az információ.

    Számomra az univerzum finomhangoltsága és az élet információ-vezérelt rendszerei nagyon erős érvek amellett, hogy a teista kiindulópont a helyes, és a naturalista kiindulópont helytelen. Ez önmagában nem vezet el senkit a zsidó-keresztény istenképhez, de nyitottá tesz annak a lehetőségnek a megfontolására, hogy a Teremtő Isten kinyilatkoztatta már magát az embereknek.

    A keresztény hit arra a meggyőződésre épül, hogy a Teremtő Isten valóban kinyilatkoztatta magát a történelemben. Kijelentette magát Ábrahámnak, Mózesnek, Izráel népének, a prófétáknak, és végül Jézus Krisztus személyében ő maga lett emberré, hogy megváltson bennünket a bűntől és a haláltól. Ezt a történelemben adott kinyilatkoztatást a feltámadt Jézus Krisztus valóságának személyes átélése teszi elevenné a keresztény hívőknek ma, a világ szinte minden táján, kulturális háttértől függetlenül. (Itt van egy beszámoló arról, amit hindu háttérből keresztény hitre térőktől hallottam Indiában, itt pedig a saját tapasztalatom.)

    Ez is kapcsolódik ide: Hitchens szabadságharca és az enyém.

  • dzsaszper says:

    Kedves Lima Rui,

    egyéb hitrendszerekben is van egy legelső láncszem, egy főisten, aki létrehozza a többit, akár a kozmosz stb.
    A filozófia és/vagy ontológia oldaláról ez a legfőbb létező problémaköre, ami megérdemelne egy kicsit kultúráltabb vitát, támaszkodva az elmúlt jópár évszázad filozófiai/ontológiai vitáira.

    Amúgy nem a véletlen létét kérdőjeleztem meg… a véletlen létét elfogadon, de az egy nagy kérdés, mekkora magyarázó erővel bír.
    Ha találnak egy licensz nélküli fizetős operációs rendszert és szoftvercsomagot a számítógépeden, te pedig azzal védekezel, hogy te csak véletlen biteket írtál a merevlemezedre öt éven át, és a százezredik kísérletnél ez lett belőle, akkor ezzel a védekezéssel vajon mire mész egy bíróságon?
    Ez a hasonlat jól leírja, mit értek a véletlen isteni tulajdonságokkal való felruházásán. Nagy különbség van a véletlen és a Véletlen között, szerintem az a probléma a neodarwinista állásponttal, hogy az előbbit emlegetve valójában az utóbbiról beszélnek.

Hozzászólás

Moderálási elvek
Új hozzászólók kommentjei és a több linket tartalmazó kommentek automatikusan moderálósorba kerülnek. Moderálási elveimről a Magamról fül alatt lehet olvasni.
Archívum